Search our product database

Search options:
Product name: hVCL €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08810-1
Sigma Product ID: EHU088101
Species: Homo sapiens
Ensembl Gene ID: ENSG00000035403
Ensembl Transcript ID: ENST00000211998, ENST00000372755, ENST00000623461
Gene coordinates (GRCh38): 10:73995193-74121363
HGNC ID: HGNC:12665
HGNC Symbol: VCL
NCBI gene: 7414
RefSeq mRNA: NM_003373, NM_014000
UniGene: Hs.643896
Sequence:CGGGTTGGAAAAGAGACTGTTCAAACCACTGAGGATCAGATTTTGAAGAGAGATA
TGCCACCAGCATTTATTAAGGTTGAGAATGCTTGCACCAAGCTTGTCCAGGCAGC
TCAGATGCTTCAGTCAGACCCTTACTCAGTGCCTGCTCGAGATTATCTAATTGAT
GGGTCAAGGGGCATCCTCTCTGGAACATCAGACCTGCTCCTTACCTTCGATGAGG
CTGAGGTCCGTAAAATTATTAGAGTTTGCAAAGGAATTTTGGAATATCTTACAGT
GGCAGAGGTGGTGGAGACTATGGAAGATTTGGTCACTTACACAAAGAATCTTGGG
CCAGGAATGACTAAGATGGCCAAGATGATTGACGAGAGACAGCAGGAGCTCACTC
ACCAGGAGCACCGAGTGATGTTGGTGAACTCGATGAACACCGTGA
Product name: hVCL €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08810-1
Sigma Product ID: EHU088101
Species: Homo sapiens
Ensembl Gene ID: ENSG00000035403
Ensembl Transcript ID: ENST00000211998, ENST00000372755, ENST00000623461
Gene coordinates (GRCh38): 10:73995193-74121363
HGNC ID: HGNC:12665
HGNC Symbol: VCL
NCBI gene: 7414
RefSeq mRNA: NM_003373, NM_014000
UniGene: Hs.643896
Sequence:CGGGTTGGAAAAGAGACTGTTCAAACCACTGAGGATCAGATTTTGAAGAGAGATA
TGCCACCAGCATTTATTAAGGTTGAGAATGCTTGCACCAAGCTTGTCCAGGCAGC
TCAGATGCTTCAGTCAGACCCTTACTCAGTGCCTGCTCGAGATTATCTAATTGAT
GGGTCAAGGGGCATCCTCTCTGGAACATCAGACCTGCTCCTTACCTTCGATGAGG
CTGAGGTCCGTAAAATTATTAGAGTTTGCAAAGGAATTTTGGAATATCTTACAGT
GGCAGAGGTGGTGGAGACTATGGAAGATTTGGTCACTTACACAAAGAATCTTGGG
CCAGGAATGACTAAGATGGCCAAGATGATTGACGAGAGACAGCAGGAGCTCACTC
ACCAGGAGCACCGAGTGATGTTGGTGAACTCGATGAACACCGTGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.