Search our product database

Search options:
Product name: hABL1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14129-1
Sigma Product ID: EHU141291
Species: Homo sapiens
Ensembl Gene ID: ENSG00000097007
Ensembl Transcript ID: ENST00000318560, ENST00000372348
Gene coordinates (GRCh38): 9:130713946-130887675
HGNC Alias: ABL, c-ABL, JTK7, p150
HGNC ID: HGNC:76
HGNC Symbol: ABL1
NCBI gene: 25
RefSeq mRNA: NM_005157, NM_007313
UniGene: Hs.431048
Sequence:TGGCAAGCTCTACGTCTCCTCCGAGAGCCGCTTCAACACCCTGGCCGAGTTGGTT
CATCATCATTCAACGGTGGCCGACGGGCTCATCACCACGCTCCATTATCCAGCCC
CAAAGCGCAACAAGCCCACTGTCTATGGTGTGTCCCCCAACTACGACAAGTGGGA
GATGGAACGCACGGACATCACCATGAAGCACAAGCTGGGCGGGGGCCAGTACGGG
GAGGTGTACGAGGGCGTGTGGAAGAAATACAGCCTGACGGTGGCCGTGAAGACCT
TGAAGGAGGACACCATGGAGGTGGAAGAGTTCTTGAAAGAAGCTGCAGTCATGAA
AGAGATCAAACACCCTAACCTGGTGCAGCTCCTTGGGGTCTGCACCCGGGAGCCC
CCGTTCTATATCATCACTGAGTTCATGACCTACGGGAACCTCCT
Product name: hABL1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14129-1
Sigma Product ID: EHU141291
Species: Homo sapiens
Ensembl Gene ID: ENSG00000097007
Ensembl Transcript ID: ENST00000318560, ENST00000372348
Gene coordinates (GRCh38): 9:130713946-130887675
HGNC Alias: ABL, c-ABL, JTK7, p150
HGNC ID: HGNC:76
HGNC Symbol: ABL1
NCBI gene: 25
RefSeq mRNA: NM_005157, NM_007313
UniGene: Hs.431048
Sequence:TGGCAAGCTCTACGTCTCCTCCGAGAGCCGCTTCAACACCCTGGCCGAGTTGGTT
CATCATCATTCAACGGTGGCCGACGGGCTCATCACCACGCTCCATTATCCAGCCC
CAAAGCGCAACAAGCCCACTGTCTATGGTGTGTCCCCCAACTACGACAAGTGGGA
GATGGAACGCACGGACATCACCATGAAGCACAAGCTGGGCGGGGGCCAGTACGGG
GAGGTGTACGAGGGCGTGTGGAAGAAATACAGCCTGACGGTGGCCGTGAAGACCT
TGAAGGAGGACACCATGGAGGTGGAAGAGTTCTTGAAAGAAGCTGCAGTCATGAA
AGAGATCAAACACCCTAACCTGGTGCAGCTCCTTGGGGTCTGCACCCGGGAGCCC
CCGTTCTATATCATCACTGAGTTCATGACCTACGGGAACCTCCT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.