Search our product database

Search options:
Product name: hCAV1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03125-1
Sigma Product ID: EHU031251
Species: Homo sapiens
Ensembl Gene ID: ENSG00000105974
Ensembl Transcript ID: ENST00000341049, ENST00000393467, ENST00000393468, ENST00000393470, ENST00000405348, ENST00000451122, ENST00000456473, ENST00000614113
Gene coordinates (GRCh38): 7:116524785-116561184
HGNC Alias: CAV
HGNC ID: HGNC:1527
HGNC Symbol: CAV1
NCBI gene: 857
RefSeq mRNA: NM_001172895, NM_001172896, NM_001172897, NM_001753
UniGene: Hs.74034
Sequence:GAGCTGAGCGAGAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTGGTCA
ACCGCGACCCTAAACACCTCAACGATGACGTGGTCAAGATTGACTTTGAAGATGT
GATTGCAGAACCAGAAGGGACACACAGTTTTGACGGCATTTGGAAGGCCAGCTTC
ACCACCTTCACTGTGACGAAATACTGGTTTTACCGCTTGCTGTCTGCCCTCTTTG
GCATCCCGATGGCACTCATCTGGGGCATTTACTTCGCCATTCTCTCTTTCCTGCA
CATCTGGGCAGTTGTACCATGCATTAAGAGCTTCCTGATTGAGATTCAGTGCATC
AGCCGTGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCTTTGAAGCTG
TTGGGAAAATATTCAGCAATGTCCGCATC
Product name: hCAV1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03125-1
Sigma Product ID: EHU031251
Species: Homo sapiens
Ensembl Gene ID: ENSG00000105974
Ensembl Transcript ID: ENST00000341049, ENST00000393467, ENST00000393468, ENST00000393470, ENST00000405348, ENST00000451122, ENST00000456473, ENST00000614113
Gene coordinates (GRCh38): 7:116524785-116561184
HGNC Alias: CAV
HGNC ID: HGNC:1527
HGNC Symbol: CAV1
NCBI gene: 857
RefSeq mRNA: NM_001172895, NM_001172896, NM_001172897, NM_001753
UniGene: Hs.74034
Sequence:GAGCTGAGCGAGAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTGGTCA
ACCGCGACCCTAAACACCTCAACGATGACGTGGTCAAGATTGACTTTGAAGATGT
GATTGCAGAACCAGAAGGGACACACAGTTTTGACGGCATTTGGAAGGCCAGCTTC
ACCACCTTCACTGTGACGAAATACTGGTTTTACCGCTTGCTGTCTGCCCTCTTTG
GCATCCCGATGGCACTCATCTGGGGCATTTACTTCGCCATTCTCTCTTTCCTGCA
CATCTGGGCAGTTGTACCATGCATTAAGAGCTTCCTGATTGAGATTCAGTGCATC
AGCCGTGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCTTTGAAGCTG
TTGGGAAAATATTCAGCAATGTCCGCATC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.