Search our product database

Search options:
Product name: hGAPDH €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14674-1
Sigma Product ID: EHU146741
Species: Homo sapiens
Ensembl Gene ID: ENSG00000111640
Ensembl Transcript ID: ENST00000229239, ENST00000396856, ENST00000396859, ENST00000396861, ENST00000466588, ENST00000474249, ENST00000492719
Gene coordinates (GRCh38): 12:6533927-6538374
HGNC Alias: GAPD
HGNC ID: HGNC:4141
HGNC Symbol: GAPDH
NCBI gene: 2597
RefSeq mRNA: NM_001289745, NM_001289746, NM_002046
Sequence:ACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCAGACACC
ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCA
CCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTT
CATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAA
TTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCA
TCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGC
TGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCT
CATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCC
CCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCAT
CAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCAT
GACAACTTTGGTATCGTGGAAGGACTCATGACCACA
Product name: hGAPDH €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14674-1
Sigma Product ID: EHU146741
Species: Homo sapiens
Ensembl Gene ID: ENSG00000111640
Ensembl Transcript ID: ENST00000229239, ENST00000396856, ENST00000396859, ENST00000396861, ENST00000466588, ENST00000474249, ENST00000492719
Gene coordinates (GRCh38): 12:6533927-6538374
HGNC Alias: GAPD
HGNC ID: HGNC:4141
HGNC Symbol: GAPDH
NCBI gene: 2597
RefSeq mRNA: NM_001289745, NM_001289746, NM_002046
Sequence:ACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCAGACACC
ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCA
CCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTT
CATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAA
TTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCA
TCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGC
TGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCT
CATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCC
CCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCAT
CAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCAT
GACAACTTTGGTATCGTGGAAGGACTCATGACCACA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.