Search our product database

Search options:
Product name: hCAT €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04867-1
Sigma Product ID: EHU048671
Species: Homo sapiens
Ensembl Gene ID: ENSG00000121691
Ensembl Transcript ID: ENST00000241052
Gene coordinates (GRCh38): 11:34438925-34472062
HGNC ID: HGNC:1516
HGNC Symbol: CAT
NCBI gene: 847
RefSeq mRNA: NM_001752
UniGene: Hs.502302
Sequence:ACATGGTCTGGGACTTCTGGAGCCTACGTCCTGAGTCTCTGCATCAGGTTTCTTT
CTTGTTCAGTGATCGGGGGATTCCAGATGGACATCGCCACATGAATGGATATGGA
TCACATACTTTCAAGCTGGTTAATGCAAATGGGGAGGCAGTTTATTGCAAATTCC
ATTATAAGACTGACCAGGGCATCAAAAACCTTTCTGTTGAAGATGCGGCGAGACT
TTCCCAGGAAGATCCTGACTATGGCATCCGGGATCTTTTTAACGCCATTGCCACA
GGAAAGTACCCCTCCTGGACTTTTTACATCCAGGTCATGACATTTAATCAGGCAG
AAACTTTTCCATTTAATCCATTCGATCTCACCAAGGTTTGGCCTCACAAGGACTA
CCCTCTCATCCCAGTTGG
Product name: hCAT €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04867-1
Sigma Product ID: EHU048671
Species: Homo sapiens
Ensembl Gene ID: ENSG00000121691
Ensembl Transcript ID: ENST00000241052
Gene coordinates (GRCh38): 11:34438925-34472062
HGNC ID: HGNC:1516
HGNC Symbol: CAT
NCBI gene: 847
RefSeq mRNA: NM_001752
UniGene: Hs.502302
Sequence:ACATGGTCTGGGACTTCTGGAGCCTACGTCCTGAGTCTCTGCATCAGGTTTCTTT
CTTGTTCAGTGATCGGGGGATTCCAGATGGACATCGCCACATGAATGGATATGGA
TCACATACTTTCAAGCTGGTTAATGCAAATGGGGAGGCAGTTTATTGCAAATTCC
ATTATAAGACTGACCAGGGCATCAAAAACCTTTCTGTTGAAGATGCGGCGAGACT
TTCCCAGGAAGATCCTGACTATGGCATCCGGGATCTTTTTAACGCCATTGCCACA
GGAAAGTACCCCTCCTGGACTTTTTACATCCAGGTCATGACATTTAATCAGGCAG
AAACTTTTCCATTTAATCCATTCGATCTCACCAAGGTTTGGCCTCACAAGGACTA
CCCTCTCATCCCAGTTGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.