Search our product database

Search options:
Product name: hCDK4 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07051-1
Sigma Product ID: EHU070511
Species: Homo sapiens
Ensembl Gene ID: ENSG00000135446, ENSG00000135452
Ensembl Transcript ID: ENST00000257904, ENST00000312990, ENST00000547992
Gene coordinates (GRCh38): 12:57738013-57750211, 12:57747727-57756013
HGNC Alias: PSK-J3, SAS
HGNC ID: HGNC:10539, HGNC:1773
HGNC Symbol: CDK4, TSPAN31
NCBI gene: 1019, 6302
RefSeq mRNA: NM_000075
UniGene: Hs.95577
Sequence:GAAACTCTGAAGCCGACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCC
AGAGGATGACTGGCCTCGAGATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGA
GGGCCCCGCCCAGTGCAGTCGGTGGTACCTGAGATGGAGGAGTCGGGAGCACAGC
TGCTGCTGGAAATGCTGACTTTTAACCCACACAAGCGAATCTCTGCCTTTCGAGC
TCTGCAGCACTCTTATCTACATAAGGATGAAGGTAATCCGGAGTGAGCAATGGAG
TGGCTGCCATGGAAGGAAGAAAAGCTGCCATTTCCCTTCTGGACACTGAGAGGGC
AATCTTTGCCTTTATCTCTGAGGCTATGGAGGGTCCTCCTCCATCTTTCTACAGA
GATTACTTTGCTGCCTTAATGACATTCCCCTCCCACCTCTCCTTTTGAGGCTTCT
CCTTCTCCTTCCCA
Product name: hCDK4 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07051-1
Sigma Product ID: EHU070511
Species: Homo sapiens
Ensembl Gene ID: ENSG00000135446, ENSG00000135452
Ensembl Transcript ID: ENST00000257904, ENST00000312990, ENST00000547992
Gene coordinates (GRCh38): 12:57738013-57750211, 12:57747727-57756013
HGNC Alias: PSK-J3, SAS
HGNC ID: HGNC:10539, HGNC:1773
HGNC Symbol: CDK4, TSPAN31
NCBI gene: 1019, 6302
RefSeq mRNA: NM_000075
UniGene: Hs.95577
Sequence:GAAACTCTGAAGCCGACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCC
AGAGGATGACTGGCCTCGAGATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGA
GGGCCCCGCCCAGTGCAGTCGGTGGTACCTGAGATGGAGGAGTCGGGAGCACAGC
TGCTGCTGGAAATGCTGACTTTTAACCCACACAAGCGAATCTCTGCCTTTCGAGC
TCTGCAGCACTCTTATCTACATAAGGATGAAGGTAATCCGGAGTGAGCAATGGAG
TGGCTGCCATGGAAGGAAGAAAAGCTGCCATTTCCCTTCTGGACACTGAGAGGGC
AATCTTTGCCTTTATCTCTGAGGCTATGGAGGGTCCTCCTCCATCTTTCTACAGA
GATTACTTTGCTGCCTTAATGACATTCCCCTCCCACCTCTCCTTTTGAGGCTTCT
CCTTCTCCTTCCCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.