Search our product database

Search options:
Product name: hPAK1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14018-1
Sigma Product ID: EHU140181
Species: Homo sapiens
Ensembl Gene ID: ENSG00000149269
Ensembl Transcript ID: ENST00000278568, ENST00000356341, ENST00000528203, ENST00000530617
Gene coordinates (GRCh38): 11:77321707-77474635
HGNC ID: HGNC:8590
HGNC Symbol: PAK1
NCBI gene: 5058
RefSeq mRNA: NM_001128620, NM_002576
Sequence:ATAGTGAGTGTGGGCGATCCTAAGAAGAAATATACACGGTTTGAGAAGATTGGAC
AAGGTGCTTCAGGCACCGTGTACACAGCAATGGATGTGGCCACAGGACAGGAGGT
GGCCATTAAGCAGATGAATCTTCAGCAGCAGCCCAAGAAAGAGCTGATTATTAAT
GAGATCCTGGTCATGAGGGAAAACAAGAACCCAAACATTGTGAATTACTTGGACA
GTTACCTCGTGGGAGATGAGCTGTGGGTTGTTATGGAATACTTGGCTGGAGGCTC
CTTGACAGATGTGGTGACAGAAACTTGCATGGATGAAGGCCAAATTGCAGCTGTG
TGCCGTGAGTGTCTGCAGGCTCTGGAGTTCTTGCATTCGAACCAGGTCATTCACA
GAGACATCAAGAGTGACAATATTCTGTTGGGAATGGATGGCTCTGTCAAGCT
Product name: hPAK1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14018-1
Sigma Product ID: EHU140181
Species: Homo sapiens
Ensembl Gene ID: ENSG00000149269
Ensembl Transcript ID: ENST00000278568, ENST00000356341, ENST00000528203, ENST00000530617
Gene coordinates (GRCh38): 11:77321707-77474635
HGNC ID: HGNC:8590
HGNC Symbol: PAK1
NCBI gene: 5058
RefSeq mRNA: NM_001128620, NM_002576
Sequence:ATAGTGAGTGTGGGCGATCCTAAGAAGAAATATACACGGTTTGAGAAGATTGGAC
AAGGTGCTTCAGGCACCGTGTACACAGCAATGGATGTGGCCACAGGACAGGAGGT
GGCCATTAAGCAGATGAATCTTCAGCAGCAGCCCAAGAAAGAGCTGATTATTAAT
GAGATCCTGGTCATGAGGGAAAACAAGAACCCAAACATTGTGAATTACTTGGACA
GTTACCTCGTGGGAGATGAGCTGTGGGTTGTTATGGAATACTTGGCTGGAGGCTC
CTTGACAGATGTGGTGACAGAAACTTGCATGGATGAAGGCCAAATTGCAGCTGTG
TGCCGTGAGTGTCTGCAGGCTCTGGAGTTCTTGCATTCGAACCAGGTCATTCACA
GAGACATCAAGAGTGACAATATTCTGTTGGGAATGGATGGCTCTGTCAAGCT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.