Search our product database

Search options:
Product name: hPLK1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05101-1
Sigma Product ID: EHU051011
Species: Homo sapiens
Ensembl Gene ID: ENSG00000166851
Ensembl Transcript ID: ENST00000300093, ENST00000562272, ENST00000567897, ENST00000568568
Gene coordinates (GRCh38): 16:23677656-23690367
HGNC Alias: PLK
HGNC ID: HGNC:9077
HGNC Symbol: PLK1
NCBI gene: 5347
RefSeq mRNA: NM_005030
UniGene: Hs.592049
Sequence:CTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTGA
ATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATA
TGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAG
GTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTA
TCATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGA
GACCTACCTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCC
GTGGCCGCCTCCCTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAA
CCATTAACGAGCTGCT
Product name: hPLK1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05101-1
Sigma Product ID: EHU051011
Species: Homo sapiens
Ensembl Gene ID: ENSG00000166851
Ensembl Transcript ID: ENST00000300093, ENST00000562272, ENST00000567897, ENST00000568568
Gene coordinates (GRCh38): 16:23677656-23690367
HGNC Alias: PLK
HGNC ID: HGNC:9077
HGNC Symbol: PLK1
NCBI gene: 5347
RefSeq mRNA: NM_005030
UniGene: Hs.592049
Sequence:CTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTGA
ATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATA
TGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAG
GTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTA
TCATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGA
GACCTACCTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCC
GTGGCCGCCTCCCTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAA
CCATTAACGAGCTGCT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.