Search our product database

Search options:
Product name: hBCL2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13528-1
Sigma Product ID: EHU135281
Species: Homo sapiens
Ensembl Gene ID: ENSG00000171791
Ensembl Transcript ID: ENST00000333681, ENST00000398117, ENST00000590515
Gene coordinates (GRCh38): 18:63123346-63320128
HGNC Alias: Bcl-2, PPP1R50
HGNC ID: HGNC:990
HGNC Symbol: BCL2
NCBI gene: 596
RefSeq mRNA: NM_000633
Sequence:CGGCCTCTGTTTGATTTCTCCTGGCTGTCTCTGAAGACTCTGCTCAGTTTGGCCC
TGGTGGGAGCTTGCATCACCCTGGGTGCCTATCTGGGCCACAAGTGAAGTCAACA
TGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGC
ATTGTCAGTGATGTACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACA
CACATATAAACATCACACACACAGACAGACACACACACACACAACAATTAACAGT
CTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATT
TTTTACATTATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACT
CCTGTCTTTGGAAATCCGACCACTAATTGCCAAGCACC
Product name: hBCL2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13528-1
Sigma Product ID: EHU135281
Species: Homo sapiens
Ensembl Gene ID: ENSG00000171791
Ensembl Transcript ID: ENST00000333681, ENST00000398117, ENST00000590515
Gene coordinates (GRCh38): 18:63123346-63320128
HGNC Alias: Bcl-2, PPP1R50
HGNC ID: HGNC:990
HGNC Symbol: BCL2
NCBI gene: 596
RefSeq mRNA: NM_000633
Sequence:CGGCCTCTGTTTGATTTCTCCTGGCTGTCTCTGAAGACTCTGCTCAGTTTGGCCC
TGGTGGGAGCTTGCATCACCCTGGGTGCCTATCTGGGCCACAAGTGAAGTCAACA
TGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGC
ATTGTCAGTGATGTACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACA
CACATATAAACATCACACACACAGACAGACACACACACACACAACAATTAACAGT
CTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATT
TTTTACATTATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACT
CCTGTCTTTGGAAATCCGACCACTAATTGCCAAGCACC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.