Search our product database

Search options:
Product name: hPTEN €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10644-1
Sigma Product ID: EHU106441
Species: Homo sapiens
Ensembl Gene ID: ENSG00000171862
Ensembl Transcript ID: ENST00000371953
Gene coordinates (GRCh38): 10:87863113-87971930
HGNC Alias: BZS, MHAM, MMAC1, PTEN1, TEP1
HGNC ID: HGNC:9588
HGNC Symbol: PTEN
NCBI gene: 5728
RefSeq mRNA: NM_000314, NM_001304717
Sequence:ACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCAC
CACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGA
AGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGT
GTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGG
CCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCC
CAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGAT
TATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGT
TCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGAT
ATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAG
TTCCCTCAGCCGTTACCT
Product name: hPTEN €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10644-1
Sigma Product ID: EHU106441
Species: Homo sapiens
Ensembl Gene ID: ENSG00000171862
Ensembl Transcript ID: ENST00000371953
Gene coordinates (GRCh38): 10:87863113-87971930
HGNC Alias: BZS, MHAM, MMAC1, PTEN1, TEP1
HGNC ID: HGNC:9588
HGNC Symbol: PTEN
NCBI gene: 5728
RefSeq mRNA: NM_000314, NM_001304717
Sequence:ACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCAC
CACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGA
AGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGT
GTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGG
CCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCC
CAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGAT
TATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGT
TCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGAT
ATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAG
TTCCCTCAGCCGTTACCT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.