guide RNA

The design and synthesis of guide RNA requires expertise and experience, and is time-consuming.

If you need high-quality custom guide (g)RNA as a tool for your CRISPR/Cas9 experiment worry-free, let Eupheria make ready-to-transfect gRNA for you. Our gRNAs are combined crRNA and tracrRNAs, so each gRNA is a single RNA molecule of about 100 nt each. Our gRNA sequences fold into an optimized scaffold with increased stability and improved assembly with Cas9 proteins in comparison with earlier generation single gRNA sequences (Cell 155: 1479-1491).

To order your custom gRNA, you may either provide the specific gRNA targeting-sequence (20 nt), or the sequence of the gene you want to target. In the latter case, Eupheria identifies the most suitable region in that gene for effective gRNA targeting free of charge. We deliver gRNA amounts from 20 µg to 500 µg.


20 µg for just 99.50 EUR

Controls

NoTarget guide RNA

10 µg for 49.50 EUR

Catalog-#: nt-gRNA-10

Purified gRNA, which has no genomic target in man, rat and mouse.
This non-targeting gRNA serves as a tool for establishing non-toxic transfection conditions, or as a negative control in down-stream assays, monitoring the success of a genome editing experiment.

GFP-targeting guide RNA

10 µg for 49.50 EUR

Catalog-#: GFP-gRNA-10

Purified gRNA, which targets sequences encoding green-fluorescent protein (GFP), or enhanced GFP.
This GFP-targeting gRNA may serve as a positive control in down-stream assays, monitoring the success of CRISPR/Cas9 genome editing experiments.  All you need is a cell line stably expressing one copy of (E)GFP. If your transfection conditions and CRISPR/Cas9 components are working, the GFP locus will be mutated. The resulting loss of GFP fluorescence can be easily determined by flow cytometry. Alternatively, analysis of the DNA will reveal mutations in the GFP locus.

Specifications

Sequence: 5'-(GG)N20GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUU

AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3'

 

The spacer sequence N20 is customized to target your gene-of-interest. It is followed by the constant structural part of the gRNA, which includes the tracr RNA, and was optimized according to Chen et al. (2013, Cell 155: 1479-1491) for improved stability of the gRNA and more efficient assembly with the Cas9 protein.

The two guanines in parentheses on the 5' end are added if they are not part of the spacer sequence.

 

 

 

Quality control: The gRNAs are designed based on the algorithms by Doench et al. (2014, Nature Biotechnology 32: 1262-1267) and Moreno-Mateos et al. (2015, Nature Methods 12: 982-988). The quality of each synthesized gRNA is checked via gel electrophoresis, and the concentration is determined by measuring A260. Each gRNA must pass a cell toxicity test.

Concentration: The standard concentration is 400 ng/µL in water. Custom concentrations are possible.

Shipment: Shipped at -20°C.