Search our product database

Search options:
Product name: hKDELR1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00004-1
Sigma Product ID: EHU000041
Species: Homo sapiens
Ensembl Gene ID: ENSG00000105438
Ensembl Transcript ID: ENST00000330720, ENST00000597017, ENST00000600980
Gene coordinates (GRCh38): 19:48382570-48391553
HGNC Alias: ERD2, ERD2.1, HDEL
HGNC ID: HGNC:6304
HGNC Symbol: KDELR1
NCBI gene: 10945
RefSeq mRNA: NM_006801
Sequence:TCGCCATCATCTTGCTACTGCTCAAAATCTGGAAGTCCCGCTCGTGCGCCGGAAT
TTCAGGGAAGAGCCAGGTCCTGTTTGCTGTGGTGTTCACTGCCCGATATCTGGAC
CTCTTCACCAACTACATCTCACTCTACAACACGTGTATGAAGGTGGTCTACATAG
CCTGCTCCTTCACCACGGTCTGGTTGATTTATAGCAAGTTCAAAGCTACTTACGA
TGGGAACCATGACACGTTCAGAGTGGAGTTCCTGGTCGTTCCCACAGCCATTCTG
GCGTTCCTGGTCAATCATGACTTCACCCCTCTGGAGATCCTCTGGACCTTCTCCA
TCTACCTGGAGTCAGTGGCCATCTTGCCGCAGCTGTTCATGGTGAGCAAGACCGG
CGAGGCGGAGACCATCACCAGCCACTACTTGTTTGCGCTAGGCGTTTACCGCACG
CTCTATCTCTTCAACTGGATCTGGCGCTACCATTTCGAGGGCTTCTTCGACCTCA
TCGCCATTGTGGCAGGCCTGGTCCAGACAGTCCTCTACTGCGATTTCTTCTACCT
CTATATCACCAAAGTCCTAAAGGGGAAGAAGTTGAGTTTGCCGG
Product name: hKDELR1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00004-1
Sigma Product ID: EHU000041
Species: Homo sapiens
Ensembl Gene ID: ENSG00000105438
Ensembl Transcript ID: ENST00000330720, ENST00000597017, ENST00000600980
Gene coordinates (GRCh38): 19:48382570-48391553
HGNC Alias: ERD2, ERD2.1, HDEL
HGNC ID: HGNC:6304
HGNC Symbol: KDELR1
NCBI gene: 10945
RefSeq mRNA: NM_006801
Sequence:TCGCCATCATCTTGCTACTGCTCAAAATCTGGAAGTCCCGCTCGTGCGCCGGAAT
TTCAGGGAAGAGCCAGGTCCTGTTTGCTGTGGTGTTCACTGCCCGATATCTGGAC
CTCTTCACCAACTACATCTCACTCTACAACACGTGTATGAAGGTGGTCTACATAG
CCTGCTCCTTCACCACGGTCTGGTTGATTTATAGCAAGTTCAAAGCTACTTACGA
TGGGAACCATGACACGTTCAGAGTGGAGTTCCTGGTCGTTCCCACAGCCATTCTG
GCGTTCCTGGTCAATCATGACTTCACCCCTCTGGAGATCCTCTGGACCTTCTCCA
TCTACCTGGAGTCAGTGGCCATCTTGCCGCAGCTGTTCATGGTGAGCAAGACCGG
CGAGGCGGAGACCATCACCAGCCACTACTTGTTTGCGCTAGGCGTTTACCGCACG
CTCTATCTCTTCAACTGGATCTGGCGCTACCATTTCGAGGGCTTCTTCGACCTCA
TCGCCATTGTGGCAGGCCTGGTCCAGACAGTCCTCTACTGCGATTTCTTCTACCT
CTATATCACCAAAGTCCTAAAGGGGAAGAAGTTGAGTTTGCCGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.