Search our product database

Search options:
Product name: hIPO8 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00026-1
Sigma Product ID: EHU000261
Species: Homo sapiens
Ensembl Gene ID: ENSG00000133704
Ensembl Transcript ID: ENST00000256079, ENST00000544829
Gene coordinates (GRCh38): 12:30628988-30695986
HGNC Alias: IMP8, RANBP8
HGNC ID: HGNC:9853
HGNC Symbol: IPO8
NCBI gene: 10526
RefSeq mRNA: NM_001190995, NM_006390
Sequence:TGCCCTTGCTCTTCAGTCTTTAATTTCTAACCAGATACAAGCTAAGGAATATATG
AAGCCACATGTGAGGCCTATTATGCAGGAACTGTTGCACATTGTTAGAGAGACAG
AAAATGATGATGTTACTAATGTCATCCAGAAGATGATATGTGAATACAGTCAAGA
GGTAGCCTCAATTGCTGTTGATATGACCCAACACTTGGCTGAGATATTTGGCAAA
GTTCTTCAAAGTGATGAATATGAAGAAGTTGAAGACAAAACAGTAATGGCTATGG
GAATTTTACATACCATTGATACTATCTTAACAGTTGTAGAAGATCATAAAGAGAT
TACCCAGCAGTTAGAGAATATCTGTCTACGGATCATTGATCTTGTTCTGCAGAAA
CATGTAATTGAATTCTATGAAGAAATTCTTTCCCTGGCATACAGTTTAACCTGCC
ACA
Product name: hIPO8 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00026-1
Sigma Product ID: EHU000261
Species: Homo sapiens
Ensembl Gene ID: ENSG00000133704
Ensembl Transcript ID: ENST00000256079, ENST00000544829
Gene coordinates (GRCh38): 12:30628988-30695986
HGNC Alias: IMP8, RANBP8
HGNC ID: HGNC:9853
HGNC Symbol: IPO8
NCBI gene: 10526
RefSeq mRNA: NM_001190995, NM_006390
Sequence:TGCCCTTGCTCTTCAGTCTTTAATTTCTAACCAGATACAAGCTAAGGAATATATG
AAGCCACATGTGAGGCCTATTATGCAGGAACTGTTGCACATTGTTAGAGAGACAG
AAAATGATGATGTTACTAATGTCATCCAGAAGATGATATGTGAATACAGTCAAGA
GGTAGCCTCAATTGCTGTTGATATGACCCAACACTTGGCTGAGATATTTGGCAAA
GTTCTTCAAAGTGATGAATATGAAGAAGTTGAAGACAAAACAGTAATGGCTATGG
GAATTTTACATACCATTGATACTATCTTAACAGTTGTAGAAGATCATAAAGAGAT
TACCCAGCAGTTAGAGAATATCTGTCTACGGATCATTGATCTTGTTCTGCAGAAA
CATGTAATTGAATTCTATGAAGAAATTCTTTCCCTGGCATACAGTTTAACCTGCC
ACA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.