Search our product database

Search options:
Product name: hAURKB €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00147-1
Sigma Product ID: EHU001471
Species: Homo sapiens
Ensembl Gene ID: ENSG00000178999
Ensembl Transcript ID: ENST00000316199, ENST00000534871, ENST00000577833, ENST00000584972, ENST00000585124
Gene coordinates (GRCh38): 17:8204733-8210600
HGNC Alias: Aik2, AIM-1, ARK2, AurB, IPL1, PPP1R48, STK12, STK5
HGNC ID: HGNC:11390
HGNC Symbol: AURKB
NCBI gene: 9212
RefSeq mRNA: NM_001256834, NM_001284526, NM_001313950, NM_001313951, NM_001313952, NM_001313954, NM_001313955, NM_004217
RefSeq ncRNA: NR_132730
Sequence:ATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCA
AAGGCAAGTTTGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTCATCGT
GGCGCTCAAGGTCCTCTTCAAGTCCCAGATAGAGAAGGAGGGCGTGGAGCATCAG
CTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATCCCAACATCCTGCGTC
TCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCC
CCGCGGGGAGCTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGA
ACAGCCACGATCATGGAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGA
AGGTGATTCACAGAGACATAAAGCCAGAAAATCTGCTCTTAGGGCTCAAGGGAGA
GCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCGCCCTCCCTGAGGAGGAAG
ACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGCATGC
ACAATGAGAAGGTGGATCTGTGGTGC
Product name: hAURKB €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00147-1
Sigma Product ID: EHU001471
Species: Homo sapiens
Ensembl Gene ID: ENSG00000178999
Ensembl Transcript ID: ENST00000316199, ENST00000534871, ENST00000577833, ENST00000584972, ENST00000585124
Gene coordinates (GRCh38): 17:8204733-8210600
HGNC Alias: Aik2, AIM-1, ARK2, AurB, IPL1, PPP1R48, STK12, STK5
HGNC ID: HGNC:11390
HGNC Symbol: AURKB
NCBI gene: 9212
RefSeq mRNA: NM_001256834, NM_001284526, NM_001313950, NM_001313951, NM_001313952, NM_001313954, NM_001313955, NM_004217
RefSeq ncRNA: NR_132730
Sequence:ATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCA
AAGGCAAGTTTGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTCATCGT
GGCGCTCAAGGTCCTCTTCAAGTCCCAGATAGAGAAGGAGGGCGTGGAGCATCAG
CTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATCCCAACATCCTGCGTC
TCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCC
CCGCGGGGAGCTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGA
ACAGCCACGATCATGGAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGA
AGGTGATTCACAGAGACATAAAGCCAGAAAATCTGCTCTTAGGGCTCAAGGGAGA
GCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCGCCCTCCCTGAGGAGGAAG
ACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGCATGC
ACAATGAGAAGGTGGATCTGTGGTGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.