Search our product database

Search options:
Product name: hAHDC1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00157-1
Sigma Product ID: EHU001571
Species: Homo sapiens
Ensembl Gene ID: ENSG00000126705
Ensembl Transcript ID: ENST00000247087, ENST00000374011, ENST00000642245, ENST00000642416, ENST00000644989
Gene coordinates (GRCh38): 1:27534035-27604431
HGNC Alias: DJ159A19.3, RP1-159A19.1
HGNC ID: HGNC:25230
HGNC Symbol: AHDC1
NCBI gene: 27245
RefSeq mRNA: NM_001029882
Sequence:TGGCTACATGGTACCCAAGGGCACCACAGCCTCTGCCACCTCTGCAGCCTCTGCC
GCCTCCTCCTCCTCCTCCTCCTTCCAGCCCTCGCCCGAGAACTGTCGGCAGTTTG
CGGGGGCTTCTCAGTGGCCTTTCCGGCAGGGCTATGGAGGCCTGGACTGGGCCTC
AGAGGCCTTTAGTCAGCTCTACAATCCCAGTTTTGACTGCCACGTCAGCGAGCCC
AACGTGATCCTGGACATCTCCAACTACACACCGCAGAAGGTGAAGCAGCAGACGG
CTGTGTCGGAGACCTTCTCTGAGTCATCCTCCGACAGCACCCAGTTCAATCAGCC
GGTTGGTGGCGGGGGGTTTCGGCGTGCCAACAGCGAGGCCTCAAGTAGTGAGGGC
CAGTCGAGCCTGTCCAGCCTGGAGAAACTGATGATGGACTGGAACGAGGCATCAT
CT
Product name: hAHDC1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00157-1
Sigma Product ID: EHU001571
Species: Homo sapiens
Ensembl Gene ID: ENSG00000126705
Ensembl Transcript ID: ENST00000247087, ENST00000374011, ENST00000642245, ENST00000642416, ENST00000644989
Gene coordinates (GRCh38): 1:27534035-27604431
HGNC Alias: DJ159A19.3, RP1-159A19.1
HGNC ID: HGNC:25230
HGNC Symbol: AHDC1
NCBI gene: 27245
RefSeq mRNA: NM_001029882
Sequence:TGGCTACATGGTACCCAAGGGCACCACAGCCTCTGCCACCTCTGCAGCCTCTGCC
GCCTCCTCCTCCTCCTCCTCCTTCCAGCCCTCGCCCGAGAACTGTCGGCAGTTTG
CGGGGGCTTCTCAGTGGCCTTTCCGGCAGGGCTATGGAGGCCTGGACTGGGCCTC
AGAGGCCTTTAGTCAGCTCTACAATCCCAGTTTTGACTGCCACGTCAGCGAGCCC
AACGTGATCCTGGACATCTCCAACTACACACCGCAGAAGGTGAAGCAGCAGACGG
CTGTGTCGGAGACCTTCTCTGAGTCATCCTCCGACAGCACCCAGTTCAATCAGCC
GGTTGGTGGCGGGGGGTTTCGGCGTGCCAACAGCGAGGCCTCAAGTAGTGAGGGC
CAGTCGAGCCTGTCCAGCCTGGAGAAACTGATGATGGACTGGAACGAGGCATCAT
CT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.