Search our product database

Search options:
Product name: hRAB2A €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00165-1
Sigma Product ID: EHU001651
Species: Homo sapiens
Ensembl Gene ID: ENSG00000104388
Ensembl Transcript ID: ENST00000262646, ENST00000466595
Gene coordinates (GRCh38): 8:60516857-60623627
HGNC Alias: RAB2
HGNC ID: HGNC:9763
HGNC Symbol: RAB2A
NCBI gene: 5862
RefSeq mRNA: NM_002865
Sequence:ACATCATAATCGGCGACACAGGTGTTGGTAAATCATGCTTATTGCTACAGTTTAC
AGACAAGAGGTTTCAGCCAGTGCATGACCTTACTATTGGTGTAGAGTTCGGTGCT
CGAATGATAACTATTGATGGGAAACAGATAAAACTTCAGATATGGGATACGGCAG
GGCAAGAATCCTTTCGTTCCATCACAAGGTCGTATTACAGAGGTGCAGCAGGAGC
TTTACTAGTTTACGATATTACACGGAGAGATACATTCAACCACTTGACAACCTGG
TTAGAAGATGCCCGCCAGCATTCCAATTCCAACATGGTCATTATGCTTATTGGAA
ATAAAAGTGATTTAGAATCTAGAAGAGAAGTAAAAAAAGAAGAAGGTGAAGCTTT
TGCACGAGAACATGGACTCATCTTCATGGAAACGTCTGCTAAGACTGCTTCCAAT
GTAGAAGAGGCATTTATTAATACAGCAAAAGAAATTTATGAAAAAATTCAAGAAG
GAGTCTTTGACATTAATAATGAGGCAAATGGCATTAAAATTGGCCCTCAGCATGC
TGCTACCAATGCAACACATGC
Product name: hRAB2A €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00165-1
Sigma Product ID: EHU001651
Species: Homo sapiens
Ensembl Gene ID: ENSG00000104388
Ensembl Transcript ID: ENST00000262646, ENST00000466595
Gene coordinates (GRCh38): 8:60516857-60623627
HGNC Alias: RAB2
HGNC ID: HGNC:9763
HGNC Symbol: RAB2A
NCBI gene: 5862
RefSeq mRNA: NM_002865
Sequence:ACATCATAATCGGCGACACAGGTGTTGGTAAATCATGCTTATTGCTACAGTTTAC
AGACAAGAGGTTTCAGCCAGTGCATGACCTTACTATTGGTGTAGAGTTCGGTGCT
CGAATGATAACTATTGATGGGAAACAGATAAAACTTCAGATATGGGATACGGCAG
GGCAAGAATCCTTTCGTTCCATCACAAGGTCGTATTACAGAGGTGCAGCAGGAGC
TTTACTAGTTTACGATATTACACGGAGAGATACATTCAACCACTTGACAACCTGG
TTAGAAGATGCCCGCCAGCATTCCAATTCCAACATGGTCATTATGCTTATTGGAA
ATAAAAGTGATTTAGAATCTAGAAGAGAAGTAAAAAAAGAAGAAGGTGAAGCTTT
TGCACGAGAACATGGACTCATCTTCATGGAAACGTCTGCTAAGACTGCTTCCAAT
GTAGAAGAGGCATTTATTAATACAGCAAAAGAAATTTATGAAAAAATTCAAGAAG
GAGTCTTTGACATTAATAATGAGGCAAATGGCATTAAAATTGGCCCTCAGCATGC
TGCTACCAATGCAACACATGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.