Search our product database

Search options:
Product name: hPLK4 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00169-1
Sigma Product ID: EHU001691
Species: Homo sapiens
Ensembl Gene ID: ENSG00000142731
Ensembl Transcript ID: ENST00000270861, ENST00000507249, ENST00000513090, ENST00000514379, ENST00000515069
Gene coordinates (GRCh38): 4:127880861-127899195
HGNC Alias: Sak, STK18
HGNC ID: HGNC:11397
HGNC Symbol: PLK4
NCBI gene: 10733
RefSeq mRNA: NM_001190799, NM_001190801, NM_014264
Sequence:CATTGCCAATTGAAACATCCTTCTATCTTGGAGCTTTATAACTATTTTGAAGATA
GCAATTATGTGTATCTGGTATTAGAAATGTGCCATAATGGAGAAATGAACAGGTA
TCTAAAGAATAGAGTGAAACCCTTCTCAGAAAATGAAGCTCGACACTTCATGCAC
CAGATCATCACAGGGATGTTGTATCTTCATTCTCATGGTATACTACACCGGGACC
TCACACTTTCTAACCTCCTACTGACTCGTAATATGAACATCAAGATTGCTGATTT
TGGGCTGGCAACTCAACTGAAAATGCCACATGAAAAGCACTATACATTATGTGGA
ACTCCTAACTACATTTCACCAGAAATTGCCACTCGAAGTGCACATGGCCTTGAAT
CTGATGTTTGGTCCCTGGGCTGTATGTTTTATACATTACTTATCGGGAGACCACC
CT
Product name: hPLK4 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00169-1
Sigma Product ID: EHU001691
Species: Homo sapiens
Ensembl Gene ID: ENSG00000142731
Ensembl Transcript ID: ENST00000270861, ENST00000507249, ENST00000513090, ENST00000514379, ENST00000515069
Gene coordinates (GRCh38): 4:127880861-127899195
HGNC Alias: Sak, STK18
HGNC ID: HGNC:11397
HGNC Symbol: PLK4
NCBI gene: 10733
RefSeq mRNA: NM_001190799, NM_001190801, NM_014264
Sequence:CATTGCCAATTGAAACATCCTTCTATCTTGGAGCTTTATAACTATTTTGAAGATA
GCAATTATGTGTATCTGGTATTAGAAATGTGCCATAATGGAGAAATGAACAGGTA
TCTAAAGAATAGAGTGAAACCCTTCTCAGAAAATGAAGCTCGACACTTCATGCAC
CAGATCATCACAGGGATGTTGTATCTTCATTCTCATGGTATACTACACCGGGACC
TCACACTTTCTAACCTCCTACTGACTCGTAATATGAACATCAAGATTGCTGATTT
TGGGCTGGCAACTCAACTGAAAATGCCACATGAAAAGCACTATACATTATGTGGA
ACTCCTAACTACATTTCACCAGAAATTGCCACTCGAAGTGCACATGGCCTTGAAT
CTGATGTTTGGTCCCTGGGCTGTATGTTTTATACATTACTTATCGGGAGACCACC
CT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.