Search our product database

Search options:
Product name: hINCENP €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00189-1
Sigma Product ID: EHU001891
Species: Homo sapiens
Ensembl Gene ID: ENSG00000149503
Ensembl Transcript ID: ENST00000278849, ENST00000394818, ENST00000528037, ENST00000533896
Gene coordinates (GRCh38): 11:62123973-62153163
HGNC Alias: FLJ31633
HGNC ID: HGNC:6058
HGNC Symbol: INCENP
NCBI gene: 3619
RefSeq mRNA: NM_001040694, NM_020238
Sequence:CACCTGCTGGAGCTATGTGACCAGAAGCTCATGGAGTTTCTCTGCAACATGGATA
ATAAGGACTTGGTGTGGCTTGAGGAAATCCAAGAGGAGGCCGAGCGCATGTTCAC
CAGAGAATTCAGCAAAGAGCCAGAGCTGATGCCCAAAACACCTTCTCAGAAGAAC
CGACGGAAGAAGAGACGGATTTCTTATGTTCAGGATGAAAACAGAGATCCCATCA
GGAGAAGGTTATCCCGCAGAAAGTCTCGGAGCAGCCAGCTGAGCTCCCGACGCCT
CCGCAGCAAGGACAGTGTAGAGAAGCTGGCTACAGTGGTCGGGGAGAACGGCTCC
GTCCTGCGGCGTGTGACCCGTGCTGCGGCTGCAGCTGCCGCGGCTACCATGGCAT
TGGCTGCACCTTCTTCACCCACCCCTGAGTCTCCCACGATGCTGACTAAGAAGCC
CG
Product name: hINCENP €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00189-1
Sigma Product ID: EHU001891
Species: Homo sapiens
Ensembl Gene ID: ENSG00000149503
Ensembl Transcript ID: ENST00000278849, ENST00000394818, ENST00000528037, ENST00000533896
Gene coordinates (GRCh38): 11:62123973-62153163
HGNC Alias: FLJ31633
HGNC ID: HGNC:6058
HGNC Symbol: INCENP
NCBI gene: 3619
RefSeq mRNA: NM_001040694, NM_020238
Sequence:CACCTGCTGGAGCTATGTGACCAGAAGCTCATGGAGTTTCTCTGCAACATGGATA
ATAAGGACTTGGTGTGGCTTGAGGAAATCCAAGAGGAGGCCGAGCGCATGTTCAC
CAGAGAATTCAGCAAAGAGCCAGAGCTGATGCCCAAAACACCTTCTCAGAAGAAC
CGACGGAAGAAGAGACGGATTTCTTATGTTCAGGATGAAAACAGAGATCCCATCA
GGAGAAGGTTATCCCGCAGAAAGTCTCGGAGCAGCCAGCTGAGCTCCCGACGCCT
CCGCAGCAAGGACAGTGTAGAGAAGCTGGCTACAGTGGTCGGGGAGAACGGCTCC
GTCCTGCGGCGTGTGACCCGTGCTGCGGCTGCAGCTGCCGCGGCTACCATGGCAT
TGGCTGCACCTTCTTCACCCACCCCTGAGTCTCCCACGATGCTGACTAAGAAGCC
CG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.