Search our product database

Search options:
Product name: hWEE1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00362-1
Sigma Product ID: EHU003621
Species: Homo sapiens
Ensembl Gene ID: ENSG00000166483
Ensembl Transcript ID: ENST00000299613, ENST00000450114
Gene coordinates (GRCh38): 11:9573681-9593457
HGNC Alias: WEE1A
HGNC ID: HGNC:12761
HGNC Symbol: WEE1
NCBI gene: 7465
RefSeq mRNA: NM_001143976, NM_003390
Sequence:GATGTGCGACAGACTCCTCAAGTGAATATTAATCCTTTTACTCCGGATTCTTTGT
TGCTTCATTCCTCAGGACAGTGTCGTCGTAGAAAGAGAACGTATTGGAATGATTC
CTGTGGTGAAGACATGGAAGCCAGTGATTATGAGCTTGAAGATGAAACAAGACCT
GCTAAGAGAATTACAATTACTGAAAGCAATATGAAGTCCCGGTATACAACAGAAT
TTCATGAGCTAGAGAAAATCGGCTCTGGAGAATTTGGTTCTGTATTTAAGTGTGT
GAAGAGGCTGGATGGATGCATTTATGCCATTAAGCGATCAAAAAAGCCATTGGCG
GGCTCTGTTGATGAGCAGAACGCTTTGAGAGAAGTATATGCTCATGCAGTGCTTG
GACAGCATTCTCATGTAGTTCGATATTTCTCTGCGTGGGCAGAAGATGATCATAT
GCTTATACAGAATGAATATTGTAATGGTGGAAGTTTAGCTGATGCTATAAGTGAA
AACTACAGAATCATGAGTTACTTTAAAGAAGCAGAGTTGAAGGATCTCCTTTTGC
AAGTTGGC
Product name: hWEE1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00362-1
Sigma Product ID: EHU003621
Species: Homo sapiens
Ensembl Gene ID: ENSG00000166483
Ensembl Transcript ID: ENST00000299613, ENST00000450114
Gene coordinates (GRCh38): 11:9573681-9593457
HGNC Alias: WEE1A
HGNC ID: HGNC:12761
HGNC Symbol: WEE1
NCBI gene: 7465
RefSeq mRNA: NM_001143976, NM_003390
Sequence:GATGTGCGACAGACTCCTCAAGTGAATATTAATCCTTTTACTCCGGATTCTTTGT
TGCTTCATTCCTCAGGACAGTGTCGTCGTAGAAAGAGAACGTATTGGAATGATTC
CTGTGGTGAAGACATGGAAGCCAGTGATTATGAGCTTGAAGATGAAACAAGACCT
GCTAAGAGAATTACAATTACTGAAAGCAATATGAAGTCCCGGTATACAACAGAAT
TTCATGAGCTAGAGAAAATCGGCTCTGGAGAATTTGGTTCTGTATTTAAGTGTGT
GAAGAGGCTGGATGGATGCATTTATGCCATTAAGCGATCAAAAAAGCCATTGGCG
GGCTCTGTTGATGAGCAGAACGCTTTGAGAGAAGTATATGCTCATGCAGTGCTTG
GACAGCATTCTCATGTAGTTCGATATTTCTCTGCGTGGGCAGAAGATGATCATAT
GCTTATACAGAATGAATATTGTAATGGTGGAAGTTTAGCTGATGCTATAAGTGAA
AACTACAGAATCATGAGTTACTTTAAAGAAGCAGAGTTGAAGGATCTCCTTTTGC
AAGTTGGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.