Search our product database

Search options:
Product name: hSAMHD1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00385-1
Sigma Product ID: EHU003851
Species: Homo sapiens
Ensembl Gene ID: ENSG00000101347
Ensembl Transcript ID: ENST00000262878, ENST00000642186, ENST00000642246, ENST00000643918, ENST00000644114, ENST00000644688, ENST00000645033, ENST00000645444, ENST00000646673, ENST00000646869, ENST00000646904, ENST00000647095, ENST00000647163, ENST00000647459
Gene coordinates (GRCh38): 20:36889773-36951901
HGNC Alias: AGS5, HDDC1, Mg11, MOP-5, SBBI88
HGNC ID: HGNC:15925
HGNC Symbol: SAMHD1
NCBI gene: 25939
RefSeq mRNA: NM_001363729, NM_001363733, NM_015474
Sequence:ACGCATGAACAAGGCTCAGTTATGATGTTTGAGCACCTTATTAATTCTAATGGAA
TTAAGCCTGTCATGGAACAATATGGTCTCATCCCTGAAGAAGATATTTGCTTTAT
AAAGGAACAAATTGTAGGACCACTTGAATCACCTGTCGAAGATTCATTGTGGCCA
TATAAAGGGCGTCCTGAAAACAAAAGCTTCCTTTATGAGATAGTATCTAATAAAA
GAAATGGCATTGATGTGGACAAATGGGATTATTTTGCCAGGGACTGCCATCATCT
TGGAATCCAAAATAATTTTGATTACAAGCGCTTTATTAAGTTTGCCCGTGTCTGT
GAAGTAGACAATGAGTTGCGTATTTGTGCTAGAGATAAGGAAGTTGGAAATCTGT
ATGACATGTTCCACACTCGCAACTCTTTACACCGTAGAGCTTATCAACACAAAGT
TGGCAACATTATTGATACAATGATTACAGATGCTTTCCTCAAAGCAGATGACTAC
ATAGAGATTACAGGTGCTGGAGGAAAAAAGTATCGCATTTCTACAGCAATTGACG
ACATGGA
Product name: hSAMHD1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00385-1
Sigma Product ID: EHU003851
Species: Homo sapiens
Ensembl Gene ID: ENSG00000101347
Ensembl Transcript ID: ENST00000262878, ENST00000642186, ENST00000642246, ENST00000643918, ENST00000644114, ENST00000644688, ENST00000645033, ENST00000645444, ENST00000646673, ENST00000646869, ENST00000646904, ENST00000647095, ENST00000647163, ENST00000647459
Gene coordinates (GRCh38): 20:36889773-36951901
HGNC Alias: AGS5, HDDC1, Mg11, MOP-5, SBBI88
HGNC ID: HGNC:15925
HGNC Symbol: SAMHD1
NCBI gene: 25939
RefSeq mRNA: NM_001363729, NM_001363733, NM_015474
Sequence:ACGCATGAACAAGGCTCAGTTATGATGTTTGAGCACCTTATTAATTCTAATGGAA
TTAAGCCTGTCATGGAACAATATGGTCTCATCCCTGAAGAAGATATTTGCTTTAT
AAAGGAACAAATTGTAGGACCACTTGAATCACCTGTCGAAGATTCATTGTGGCCA
TATAAAGGGCGTCCTGAAAACAAAAGCTTCCTTTATGAGATAGTATCTAATAAAA
GAAATGGCATTGATGTGGACAAATGGGATTATTTTGCCAGGGACTGCCATCATCT
TGGAATCCAAAATAATTTTGATTACAAGCGCTTTATTAAGTTTGCCCGTGTCTGT
GAAGTAGACAATGAGTTGCGTATTTGTGCTAGAGATAAGGAAGTTGGAAATCTGT
ATGACATGTTCCACACTCGCAACTCTTTACACCGTAGAGCTTATCAACACAAAGT
TGGCAACATTATTGATACAATGATTACAGATGCTTTCCTCAAAGCAGATGACTAC
ATAGAGATTACAGGTGCTGGAGGAAAAAAGTATCGCATTTCTACAGCAATTGACG
ACATGGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.