Search our product database

Search options:
Product name: hHNRNPU €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00465-1
Sigma Product ID: EHU004651
Species: Homo sapiens
Ensembl Gene ID: ENSG00000153187
Ensembl Transcript ID: ENST00000366525, ENST00000440865, ENST00000444376, ENST00000476241, ENST00000638475, ENST00000638952, ENST00000640056, ENST00000640218, ENST00000640306, ENST00000640440, ENST00000649899
Gene coordinates (GRCh38): 1:244840638-244864560
HGNC Alias: C1orf199, FLJ30202, FLJ37978, hnRNPU, HNRNPU-AS1, HNRPU, NCRNA00201, SAF-A
HGNC ID: HGNC:5048
HGNC Symbol: HNRNPU
NCBI gene: 3192
RefSeq mRNA: NM_004501, NM_031844
Sequence:AGCAGAGCCAAATCTCCTCAGCCACCTGTTGAAGAAGAAGATGAACACTTCGATG
ACACAGTGGTTTGTCTTGATACTTATAATTGTGATCTACATTTTAAAATATCAAG
AGATCGTCTCAGTGCTTCTTCCCTTACAATGGAGAGTTTTGCTTTTCTTTGGGCT
GGAGGAAGAGCATCCTATGGTGTGTCAAAAGGCAAAGTGTGTTTTGAGATGAAGG
TTACAGAGAAGATCCCAGTAAGGCATTTATATACAAAAGATATTGACATACATGA
AGTTCGTATTGGCTGGTCACTAACTACAAGTGGAATGTTACTTGGTGAAGAAGAA
TTTTCTTATGGGTATTCTCTAAAAGGAATAAAAACATGCAACTGTGAGACTGAAG
ATTATGGAGAAAAGTTTGATGAAAATGATGTGATTACATGTTTTGCTAACTTTGA
AAGTGATGAAGTAGAACTCTCGTATGCTAAGAATGGACAAGATCTTGGCGTTGCC
TTCAAAATCAGTAAGGAAGTTCTTGCTGGACGGCCACTGTTCCCGCATGTTCTCT
Product name: hHNRNPU €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00465-1
Sigma Product ID: EHU004651
Species: Homo sapiens
Ensembl Gene ID: ENSG00000153187
Ensembl Transcript ID: ENST00000366525, ENST00000440865, ENST00000444376, ENST00000476241, ENST00000638475, ENST00000638952, ENST00000640056, ENST00000640218, ENST00000640306, ENST00000640440, ENST00000649899
Gene coordinates (GRCh38): 1:244840638-244864560
HGNC Alias: C1orf199, FLJ30202, FLJ37978, hnRNPU, HNRNPU-AS1, HNRPU, NCRNA00201, SAF-A
HGNC ID: HGNC:5048
HGNC Symbol: HNRNPU
NCBI gene: 3192
RefSeq mRNA: NM_004501, NM_031844
Sequence:AGCAGAGCCAAATCTCCTCAGCCACCTGTTGAAGAAGAAGATGAACACTTCGATG
ACACAGTGGTTTGTCTTGATACTTATAATTGTGATCTACATTTTAAAATATCAAG
AGATCGTCTCAGTGCTTCTTCCCTTACAATGGAGAGTTTTGCTTTTCTTTGGGCT
GGAGGAAGAGCATCCTATGGTGTGTCAAAAGGCAAAGTGTGTTTTGAGATGAAGG
TTACAGAGAAGATCCCAGTAAGGCATTTATATACAAAAGATATTGACATACATGA
AGTTCGTATTGGCTGGTCACTAACTACAAGTGGAATGTTACTTGGTGAAGAAGAA
TTTTCTTATGGGTATTCTCTAAAAGGAATAAAAACATGCAACTGTGAGACTGAAG
ATTATGGAGAAAAGTTTGATGAAAATGATGTGATTACATGTTTTGCTAACTTTGA
AAGTGATGAAGTAGAACTCTCGTATGCTAAGAATGGACAAGATCTTGGCGTTGCC
TTCAAAATCAGTAAGGAAGTTCTTGCTGGACGGCCACTGTTCCCGCATGTTCTCT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.