Search our product database

Search options:
Product name: hCCP110 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00726-1
Sigma Product ID: EHU007261
Species: Homo sapiens
Ensembl Gene ID: ENSG00000103540
Ensembl Transcript ID: ENST00000381396, ENST00000396208, ENST00000396212
Gene coordinates (GRCh38): 16:19523811-19553408
HGNC Alias: CP110, KIAA0419
HGNC ID: HGNC:24342
HGNC Symbol: CCP110
NCBI gene: 9738
RefSeq mRNA: NM_001199022, NM_001323569, NM_001323570, NM_001323571, NM_001323572, NM_001323576, NM_001323577, NM_014711
Sequence:CGAGCTGCCTTGTACGGTATTCATGACATATTCTTTGTAATGGATGCAGCTGAAA
GAATGTCTATTCTACATCATGATCGAGAAGTTCGCAAAGAGAAAATGCTCAGGCA
AATGGATAAAATGAAAAGTCCACGAGTGGCTCTTTCAGCTGCAACACAGAAGTCT
CTTGATAGGAAGAAATACATGAAAGCTGCTGAAATGGGAATGCCAAATAAGAAAT
TTCTGGTTAAACAAAATCCTTCTGAAACAAGAGTCCTTCAGCCAAACCAAGGACA
GAATGCACCTGTTCATAGGCTACTTAGTAGACAAGGGAGTATATGCAGGAAAAAT
CCAAAGAAAGCGGCCAAATGTTGCGACAATTTAAGAAGACAACATTCATTAGGAT
AAAATGGGGGGAAGGATTATTATTCATGTTATTTTCCCTGCCCAAGACTT
Product name: hCCP110 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00726-1
Sigma Product ID: EHU007261
Species: Homo sapiens
Ensembl Gene ID: ENSG00000103540
Ensembl Transcript ID: ENST00000381396, ENST00000396208, ENST00000396212
Gene coordinates (GRCh38): 16:19523811-19553408
HGNC Alias: CP110, KIAA0419
HGNC ID: HGNC:24342
HGNC Symbol: CCP110
NCBI gene: 9738
RefSeq mRNA: NM_001199022, NM_001323569, NM_001323570, NM_001323571, NM_001323572, NM_001323576, NM_001323577, NM_014711
Sequence:CGAGCTGCCTTGTACGGTATTCATGACATATTCTTTGTAATGGATGCAGCTGAAA
GAATGTCTATTCTACATCATGATCGAGAAGTTCGCAAAGAGAAAATGCTCAGGCA
AATGGATAAAATGAAAAGTCCACGAGTGGCTCTTTCAGCTGCAACACAGAAGTCT
CTTGATAGGAAGAAATACATGAAAGCTGCTGAAATGGGAATGCCAAATAAGAAAT
TTCTGGTTAAACAAAATCCTTCTGAAACAAGAGTCCTTCAGCCAAACCAAGGACA
GAATGCACCTGTTCATAGGCTACTTAGTAGACAAGGGAGTATATGCAGGAAAAAT
CCAAAGAAAGCGGCCAAATGTTGCGACAATTTAAGAAGACAACATTCATTAGGAT
AAAATGGGGGGAAGGATTATTATTCATGTTATTTTCCCTGCCCAAGACTT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.