Search our product database

Search options:
Product name: hSSBP1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00975-1
Sigma Product ID: EHU009751
Species: Homo sapiens
Ensembl Gene ID: ENSG00000106028
Ensembl Transcript ID: ENST00000265304, ENST00000465582, ENST00000469123, ENST00000481508, ENST00000484178, ENST00000498107, ENST00000612337
Gene coordinates (GRCh38): 7:141738321-141787922
HGNC Alias: mtSSB, SSBP
HGNC ID: HGNC:11317
HGNC Symbol: SSBP1
NCBI gene: 6742
RefSeq mRNA: NM_001256510, NM_001256511, NM_001256512, NM_001256513, NM_003143
RefSeq ncRNA: NR_046269
Sequence:CGGGTTAGATCGTCAGGAAAAGCCTAAAGATTAGACTGTAAGAAAAGAAAATAGA
AGCCATGTTTCGAAGACCTGTATTACAGGTACTTCGTCAGTTTGTAAGACATGAG
TCCGAAACAACTACCAGTTTGGTTCTTGAAAGATCCCTGAATCGTGTGCACTTAC
TTGGGCGAGTGGGTCAGGACCCTGTCTTGAGACAGGTGGAAGGAAAAAATCCAGT
CACAATATTTTCTCTAGCAACTAATGAGATGTGGCGATCAGGGGATAGTGAAGTT
TACCAACTGGGTGATGTCAGTCAAAAGACAACATGGCACAGAATATCAGTATTCC
GGCCAGGCCTCAGAGACGTGGCATATCAATATGTGAAAAAGGGGTCTCGAATTTA
TTTGGAAGGGAAAATAGACTATGGTGAATACATGGATAAAAATAATGTGAGGCGA
CAAGCAACAACAATCATAGCTGATAATATTATATTTCTGAGTGACCAGACGAAAG
AGAAGGAGTAGAAAGGATGATTCTTCTTTGGCCA
Product name: hSSBP1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00975-1
Sigma Product ID: EHU009751
Species: Homo sapiens
Ensembl Gene ID: ENSG00000106028
Ensembl Transcript ID: ENST00000265304, ENST00000465582, ENST00000469123, ENST00000481508, ENST00000484178, ENST00000498107, ENST00000612337
Gene coordinates (GRCh38): 7:141738321-141787922
HGNC Alias: mtSSB, SSBP
HGNC ID: HGNC:11317
HGNC Symbol: SSBP1
NCBI gene: 6742
RefSeq mRNA: NM_001256510, NM_001256511, NM_001256512, NM_001256513, NM_003143
RefSeq ncRNA: NR_046269
Sequence:CGGGTTAGATCGTCAGGAAAAGCCTAAAGATTAGACTGTAAGAAAAGAAAATAGA
AGCCATGTTTCGAAGACCTGTATTACAGGTACTTCGTCAGTTTGTAAGACATGAG
TCCGAAACAACTACCAGTTTGGTTCTTGAAAGATCCCTGAATCGTGTGCACTTAC
TTGGGCGAGTGGGTCAGGACCCTGTCTTGAGACAGGTGGAAGGAAAAAATCCAGT
CACAATATTTTCTCTAGCAACTAATGAGATGTGGCGATCAGGGGATAGTGAAGTT
TACCAACTGGGTGATGTCAGTCAAAAGACAACATGGCACAGAATATCAGTATTCC
GGCCAGGCCTCAGAGACGTGGCATATCAATATGTGAAAAAGGGGTCTCGAATTTA
TTTGGAAGGGAAAATAGACTATGGTGAATACATGGATAAAAATAATGTGAGGCGA
CAAGCAACAACAATCATAGCTGATAATATTATATTTCTGAGTGACCAGACGAAAG
AGAAGGAGTAGAAAGGATGATTCTTCTTTGGCCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.