Search our product database

Search options:
Product name: hSNN €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01043-1
Sigma Product ID: EHU010431
Species: Homo sapiens
Ensembl Gene ID: ENSG00000184602
Ensembl Transcript ID: ENST00000329565
Gene coordinates (GRCh38): 16:11668414-11679159
HGNC ID: HGNC:11149
HGNC Symbol: SNN
NCBI gene: 8303
RefSeq mRNA: NM_003498
Sequence:CAGAGGACGAGGAGAGCATCGTGGGGGATGGGGAGACCAAGGAACCCTTCCTGCT
GGTGCAGTATTCGGCCAAGGGACCGTGCGTGGAGAGAAAGGCCAAGCTGATGACT
CCCAACGGCCCGGAAGTCCACGGCTGAGCCAGGATGCAAGGCTCCTGGTCCTGTT
TGCAGCCGGCCAAGAGGCGCTGGGAGGGGCAAAACCATACGGATGCGCTGCTGTC
TGAGAGGAAGGGCTGACACTTGCTGGCATGGCCTCTGCGGGCTTCGTCATCGCAT
GCACTGATGCCCGGGGACCTGGCTGTCCTGGGCTTCCCCTCGGCCTCCAGGTGAG
GCTGCCCATTGCAGGCACTGGGCAGGCCTGACCTTGCTGGGGCTCATGGCCCTGT
AGCGCTTTTGTTACTTGAATGTCTAGCTGAGCCTGTTTTTGATGGAG
Product name: hSNN €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01043-1
Sigma Product ID: EHU010431
Species: Homo sapiens
Ensembl Gene ID: ENSG00000184602
Ensembl Transcript ID: ENST00000329565
Gene coordinates (GRCh38): 16:11668414-11679159
HGNC ID: HGNC:11149
HGNC Symbol: SNN
NCBI gene: 8303
RefSeq mRNA: NM_003498
Sequence:CAGAGGACGAGGAGAGCATCGTGGGGGATGGGGAGACCAAGGAACCCTTCCTGCT
GGTGCAGTATTCGGCCAAGGGACCGTGCGTGGAGAGAAAGGCCAAGCTGATGACT
CCCAACGGCCCGGAAGTCCACGGCTGAGCCAGGATGCAAGGCTCCTGGTCCTGTT
TGCAGCCGGCCAAGAGGCGCTGGGAGGGGCAAAACCATACGGATGCGCTGCTGTC
TGAGAGGAAGGGCTGACACTTGCTGGCATGGCCTCTGCGGGCTTCGTCATCGCAT
GCACTGATGCCCGGGGACCTGGCTGTCCTGGGCTTCCCCTCGGCCTCCAGGTGAG
GCTGCCCATTGCAGGCACTGGGCAGGCCTGACCTTGCTGGGGCTCATGGCCCTGT
AGCGCTTTTGTTACTTGAATGTCTAGCTGAGCCTGTTTTTGATGGAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.