Search our product database

Search options:
Product name: hGRSF1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01154-1
Sigma Product ID: EHU011541
Species: Homo sapiens
Ensembl Gene ID: ENSG00000132463
Ensembl Transcript ID: ENST00000254799, ENST00000499044, ENST00000502323, ENST00000505068, ENST00000514161, ENST00000545193
Gene coordinates (GRCh38): 4:70815782-70839945
HGNC ID: HGNC:4610
HGNC Symbol: GRSF1
NCBI gene: 2926
RefSeq mRNA: NM_001098477, NM_002092
Sequence:TGGAGTCAGAGCAGGATGTGCAGAAAGCCTTAGAGAAGCACCGCATGTACATGGG
CCAGCGGTATGTGGAAGTATATGAGATAAACAATGAAGATGTGGATGCCTTAATG
AAGAGCTTGCAGGTCAAATCTTCGCCTGTGGTAAATGATGGTGTGGTTCGTTTGA
GAGGACTTCCTTATAGTTGCAATGAGAAAGACATTGTAGACTTCTTTGCAGGACT
GAATATAGTTGACATTACTTTTGTGATGGACTATAGAGGGAGGCGAAAAACAGGG
GAAGCCTATGTGCAATTTGAAGAACCAGAAATGGCCAACCAAGCCCTGTTGAAAC
ACAGGGAAGAAATTGGTAATCGATACATCGAGATATTTCCAAGCAGAAGGAATGA
AGTTCGAACACATGTCGGTTCTTATAAGGGAAAGAAAATCGCATCTTTTCCTACT
GCTAAGTATATAACTGAGCCAGAAATGGTCTTTGAAGAACATGAAGTAAATGAGG
ATATTCAACCCATGACAGCTTTTGA
Product name: hGRSF1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01154-1
Sigma Product ID: EHU011541
Species: Homo sapiens
Ensembl Gene ID: ENSG00000132463
Ensembl Transcript ID: ENST00000254799, ENST00000499044, ENST00000502323, ENST00000505068, ENST00000514161, ENST00000545193
Gene coordinates (GRCh38): 4:70815782-70839945
HGNC ID: HGNC:4610
HGNC Symbol: GRSF1
NCBI gene: 2926
RefSeq mRNA: NM_001098477, NM_002092
Sequence:TGGAGTCAGAGCAGGATGTGCAGAAAGCCTTAGAGAAGCACCGCATGTACATGGG
CCAGCGGTATGTGGAAGTATATGAGATAAACAATGAAGATGTGGATGCCTTAATG
AAGAGCTTGCAGGTCAAATCTTCGCCTGTGGTAAATGATGGTGTGGTTCGTTTGA
GAGGACTTCCTTATAGTTGCAATGAGAAAGACATTGTAGACTTCTTTGCAGGACT
GAATATAGTTGACATTACTTTTGTGATGGACTATAGAGGGAGGCGAAAAACAGGG
GAAGCCTATGTGCAATTTGAAGAACCAGAAATGGCCAACCAAGCCCTGTTGAAAC
ACAGGGAAGAAATTGGTAATCGATACATCGAGATATTTCCAAGCAGAAGGAATGA
AGTTCGAACACATGTCGGTTCTTATAAGGGAAAGAAAATCGCATCTTTTCCTACT
GCTAAGTATATAACTGAGCCAGAAATGGTCTTTGAAGAACATGAAGTAAATGAGG
ATATTCAACCCATGACAGCTTTTGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.