Search our product database

Search options:
Product name: hKIF20A €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01233-1
Sigma Product ID: EHU012331
Species: Homo sapiens
Ensembl Gene ID: ENSG00000112984
Ensembl Transcript ID: ENST00000394894, ENST00000504621
Gene coordinates (GRCh38): 5:138178719-138187715
HGNC Alias: RAB6KIFL
HGNC ID: HGNC:9787
HGNC Symbol: KIF20A
NCBI gene: 10112
RefSeq mRNA: NM_005733
Sequence:ACAAGCAGCAGGTTCCATCTGAGGACAGTATGGAGAAGGTGAAAGTATACTTGAG
GGTTAGGCCCTTGTTACCTTCAGAGTTGGAACGACAGGAAGATCAGGGTTGTGTC
CGTATTGAGAATGTGGAGACCCTTGTTCTACAAGCACCCAAGGACTCTTTTGCCC
TGAAGAGCAATGAACGGGGAATTGGCCAAGCCACACACAGGTTCACCTTTTCCCA
GATCTTTGGGCCAGAAGTGGGACAGGCATCCTTCTTCAACCTAACTGTGAAGGAG
ATGGTAAAGGATGTACTCAAAGGGCAGAACTGGCTCATCTATACATATGGAGTCA
CTAACTCAGGGAAAACCCACACGATTCAAGGTACCATCAAGGATGGAGGGATTCT
CCCCCGGTCCCTGGCGCTGATCTTCAATAGCCTCCAAGGCCAACT
Product name: hKIF20A €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01233-1
Sigma Product ID: EHU012331
Species: Homo sapiens
Ensembl Gene ID: ENSG00000112984
Ensembl Transcript ID: ENST00000394894, ENST00000504621
Gene coordinates (GRCh38): 5:138178719-138187715
HGNC Alias: RAB6KIFL
HGNC ID: HGNC:9787
HGNC Symbol: KIF20A
NCBI gene: 10112
RefSeq mRNA: NM_005733
Sequence:ACAAGCAGCAGGTTCCATCTGAGGACAGTATGGAGAAGGTGAAAGTATACTTGAG
GGTTAGGCCCTTGTTACCTTCAGAGTTGGAACGACAGGAAGATCAGGGTTGTGTC
CGTATTGAGAATGTGGAGACCCTTGTTCTACAAGCACCCAAGGACTCTTTTGCCC
TGAAGAGCAATGAACGGGGAATTGGCCAAGCCACACACAGGTTCACCTTTTCCCA
GATCTTTGGGCCAGAAGTGGGACAGGCATCCTTCTTCAACCTAACTGTGAAGGAG
ATGGTAAAGGATGTACTCAAAGGGCAGAACTGGCTCATCTATACATATGGAGTCA
CTAACTCAGGGAAAACCCACACGATTCAAGGTACCATCAAGGATGGAGGGATTCT
CCCCCGGTCCCTGGCGCTGATCTTCAATAGCCTCCAAGGCCAACT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.