Search our product database

Search options:
Product name: hPFDN2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01337-1
Sigma Product ID: EHU013371
Species: Homo sapiens
Ensembl Gene ID: ENSG00000143256
Ensembl Transcript ID: ENST00000368010
Gene coordinates (GRCh38): 1:161100556-161118111
HGNC ID: HGNC:8867
HGNC Symbol: PFDN2
NCBI gene: 5202
RefSeq mRNA: NM_012394
Sequence:GAAGATGGCGGAGAACAGCGGTCGCGCCGGCAAGAGCAGCGGGAGCGGCGCGGGG
AAGGGGGCGGTGTCCGCAGAGCAGGTGATTGCTGGCTTCAACCGCCTTCGGCAGG
AACAGCGAGGCCTGGCATCCAAAGCAGCTGAGTTGGAGATGGAGTTGAATGAGCA
CAGCCTAGTGATCGATACACTGAAGGAGGTAGATGAAACTCGTAAGTGCTACCGC
ATGGTTGGAGGAGTGCTGGTGGAGCGAACTGTCAAAGAGGTGCTGCCCGCTTTGG
AGAACAACAAGGAGCAGATACAGAAGATCATTGAGACACTGACACAGCAGCTTCA
GGCAAAGGGAAAAGAACTAAATGAATTCCGGGAAAAGCACAACATTCGTCTCATG
GGAGAAGATGAGAAGCCAGCAGCCAAGGAAAACTCAGAAGGGGC
Product name: hPFDN2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01337-1
Sigma Product ID: EHU013371
Species: Homo sapiens
Ensembl Gene ID: ENSG00000143256
Ensembl Transcript ID: ENST00000368010
Gene coordinates (GRCh38): 1:161100556-161118111
HGNC ID: HGNC:8867
HGNC Symbol: PFDN2
NCBI gene: 5202
RefSeq mRNA: NM_012394
Sequence:GAAGATGGCGGAGAACAGCGGTCGCGCCGGCAAGAGCAGCGGGAGCGGCGCGGGG
AAGGGGGCGGTGTCCGCAGAGCAGGTGATTGCTGGCTTCAACCGCCTTCGGCAGG
AACAGCGAGGCCTGGCATCCAAAGCAGCTGAGTTGGAGATGGAGTTGAATGAGCA
CAGCCTAGTGATCGATACACTGAAGGAGGTAGATGAAACTCGTAAGTGCTACCGC
ATGGTTGGAGGAGTGCTGGTGGAGCGAACTGTCAAAGAGGTGCTGCCCGCTTTGG
AGAACAACAAGGAGCAGATACAGAAGATCATTGAGACACTGACACAGCAGCTTCA
GGCAAAGGGAAAAGAACTAAATGAATTCCGGGAAAAGCACAACATTCGTCTCATG
GGAGAAGATGAGAAGCCAGCAGCCAAGGAAAACTCAGAAGGGGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.