Search our product database

Search options:
Product name: hMSH2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01356-1
Sigma Product ID: EHU013561
Species: Homo sapiens
Ensembl Gene ID: ENSG00000095002
Ensembl Transcript ID: ENST00000233146, ENST00000543555
Gene coordinates (GRCh38): 2:47402969-47663146
HGNC Alias: COCA1, HNPCC, HNPCC1
HGNC ID: HGNC:7325
HGNC Symbol: MSH2
NCBI gene: 4436
RefSeq mRNA: NM_000251, NM_001258281
Sequence:TTCATGGCTGAAATGTTGGAAACTGCTTCTATCCTCAGGTCTGCAACCAAAGATT
CATTAATAATCATAGATGAATTGGGAAGAGGAACTTCTACCTACGATGGATTTGG
GTTAGCATGGGCTATATCAGAATACATTGCAACAAAGATTGGTGCTTTTTGCATG
TTTGCAACCCATTTTCATGAACTTACTGCCTTGGCCAATCAGATACCAACTGTTA
ATAATCTACATGTCACAGCACTCACCACTGAAGAGACCTTAACTATGCTTTATCA
GGTGAAGAAAGGTGTCTGTGATCAAAGTTTTGGGATTCATGTTGCAGAGCTTGCT
AATTTCCCTAAGCATGTAATAGAGTGTGCTAAACAGAAAGCCCTGGAACTTGAGG
AGTTTCAGTATATTGGAGAATCGCAAGGATATGATATCATGGAACCAGCAGCAAA
GAAGTGCTATCTGGAAAGAGAGCAAGGTGAAAAAATTATTCAGGAGTTCCTGTCC
AAGGTGAAACAAATGCCCT
Product name: hMSH2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01356-1
Sigma Product ID: EHU013561
Species: Homo sapiens
Ensembl Gene ID: ENSG00000095002
Ensembl Transcript ID: ENST00000233146, ENST00000543555
Gene coordinates (GRCh38): 2:47402969-47663146
HGNC Alias: COCA1, HNPCC, HNPCC1
HGNC ID: HGNC:7325
HGNC Symbol: MSH2
NCBI gene: 4436
RefSeq mRNA: NM_000251, NM_001258281
Sequence:TTCATGGCTGAAATGTTGGAAACTGCTTCTATCCTCAGGTCTGCAACCAAAGATT
CATTAATAATCATAGATGAATTGGGAAGAGGAACTTCTACCTACGATGGATTTGG
GTTAGCATGGGCTATATCAGAATACATTGCAACAAAGATTGGTGCTTTTTGCATG
TTTGCAACCCATTTTCATGAACTTACTGCCTTGGCCAATCAGATACCAACTGTTA
ATAATCTACATGTCACAGCACTCACCACTGAAGAGACCTTAACTATGCTTTATCA
GGTGAAGAAAGGTGTCTGTGATCAAAGTTTTGGGATTCATGTTGCAGAGCTTGCT
AATTTCCCTAAGCATGTAATAGAGTGTGCTAAACAGAAAGCCCTGGAACTTGAGG
AGTTTCAGTATATTGGAGAATCGCAAGGATATGATATCATGGAACCAGCAGCAAA
GAAGTGCTATCTGGAAAGAGAGCAAGGTGAAAAAATTATTCAGGAGTTCCTGTCC
AAGGTGAAACAAATGCCCT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.