Search our product database

Search options:
Product name: hPIR €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01389-1
Sigma Product ID: EHU013891
Species: Homo sapiens
Ensembl Gene ID: ENSG00000087842
Ensembl Transcript ID: ENST00000380420, ENST00000380421
Gene coordinates (GRCh38): X:15384799-15493564
HGNC ID: HGNC:30048
HGNC Symbol: PIR
NCBI gene: 8544
RefSeq mRNA: NM_001018109, NM_003662
Sequence:GGATGGTGTGACAGTTGCTGTCATTTCTGGAGAAGCCCTGGGAATAAAGTCCAAG
GTTTACACTCGCACACCAACCTTATATTTGGACTTCAAATTGGACCCAGGAGCCA
AACATTCCCAACCTATCCCTAAAGGGTGGACAAGCTTCATTTACACGATATCTGG
AGATGTGTATATTGGGCCCGATGATGCACAACAAAAAATAGAACCTCATCACACA
GCAGTGCTTGGAGAAGGTGACAGTGTCCAGGTGGAGAACAAGGATCCCAAGAGAA
GCCACTTTGTCTTAATTGCTGGGGAGCCATTAAGAGAACCAGTTATCCAACATGG
TCCATTTGTGATGAACACCAATGAAGAGATTTCTCAAGCTATTCTTGATTTCAGA
AACGCAAAAAATGGGTTTGAAAGGGCCAAAACCTGGAAATCAAAGATTGGGAACT
AGTGGAAAGCGGAAGAGCAGGTCTTGATGTGTCCTAGAATTTTGCCATTTCTGAG
ATTGAGCCATTGAAGGCAT
Product name: hPIR €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01389-1
Sigma Product ID: EHU013891
Species: Homo sapiens
Ensembl Gene ID: ENSG00000087842
Ensembl Transcript ID: ENST00000380420, ENST00000380421
Gene coordinates (GRCh38): X:15384799-15493564
HGNC ID: HGNC:30048
HGNC Symbol: PIR
NCBI gene: 8544
RefSeq mRNA: NM_001018109, NM_003662
Sequence:GGATGGTGTGACAGTTGCTGTCATTTCTGGAGAAGCCCTGGGAATAAAGTCCAAG
GTTTACACTCGCACACCAACCTTATATTTGGACTTCAAATTGGACCCAGGAGCCA
AACATTCCCAACCTATCCCTAAAGGGTGGACAAGCTTCATTTACACGATATCTGG
AGATGTGTATATTGGGCCCGATGATGCACAACAAAAAATAGAACCTCATCACACA
GCAGTGCTTGGAGAAGGTGACAGTGTCCAGGTGGAGAACAAGGATCCCAAGAGAA
GCCACTTTGTCTTAATTGCTGGGGAGCCATTAAGAGAACCAGTTATCCAACATGG
TCCATTTGTGATGAACACCAATGAAGAGATTTCTCAAGCTATTCTTGATTTCAGA
AACGCAAAAAATGGGTTTGAAAGGGCCAAAACCTGGAAATCAAAGATTGGGAACT
AGTGGAAAGCGGAAGAGCAGGTCTTGATGTGTCCTAGAATTTTGCCATTTCTGAG
ATTGAGCCATTGAAGGCAT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.