Search our product database

Search options:
Product name: hCCDC115 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01762-1
Sigma Product ID: EHU017621
Species: Homo sapiens
Ensembl Gene ID: ENSG00000136710
Ensembl Transcript ID: ENST00000259229, ENST00000409127, ENST00000442217, ENST00000465315
Gene coordinates (GRCh38): 2:130338241-130342349
HGNC Alias: ccp1, FLJ30131, MGC12981
HGNC ID: HGNC:28178
HGNC Symbol: CCDC115
NCBI gene: 84317
RefSeq mRNA: NM_001321118, NM_001321119, NM_032357
RefSeq ncRNA: NR_104471, NR_135548
Sequence:AAGGTGGTGAGAGCTGGTGTCCACGCCCCAGAGGAGGTGGGGCCTCGCGAAGCAG
GTCTGCGGAGGCGCAAGGGCCCCACTAAGACCCCAGAACCGGAGTCCTCTGAGGC
CCCTCAGGACCCCCTGAACTGGTTTGGAATCCTAGTTCCTCACAGTCTACGTCAG
GCTCAAGCAAGCTTCCGGGATGGCCTGCAGCTGGCCGCAGACATAGCCAGCCTCC
AGAACCGCATTGACTGGGGTCGAAGCCAGCTCCGGGGACTCCAAGAGAAACTCAA
GCAGCTGGAGCCTGGGGCTGCCTGACATGCGCGCAAAGAGGCAGGGCAGCGAGCA
CAGCTGTTCTCCGACATGGCTACGTGATCTCAGGCCTTCTTCCTTCACAATTAGC
TCTTGCCCCTACCCCACGCCAGCTAATGCCCCTTCTGTGTC
Product name: hCCDC115 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01762-1
Sigma Product ID: EHU017621
Species: Homo sapiens
Ensembl Gene ID: ENSG00000136710
Ensembl Transcript ID: ENST00000259229, ENST00000409127, ENST00000442217, ENST00000465315
Gene coordinates (GRCh38): 2:130338241-130342349
HGNC Alias: ccp1, FLJ30131, MGC12981
HGNC ID: HGNC:28178
HGNC Symbol: CCDC115
NCBI gene: 84317
RefSeq mRNA: NM_001321118, NM_001321119, NM_032357
RefSeq ncRNA: NR_104471, NR_135548
Sequence:AAGGTGGTGAGAGCTGGTGTCCACGCCCCAGAGGAGGTGGGGCCTCGCGAAGCAG
GTCTGCGGAGGCGCAAGGGCCCCACTAAGACCCCAGAACCGGAGTCCTCTGAGGC
CCCTCAGGACCCCCTGAACTGGTTTGGAATCCTAGTTCCTCACAGTCTACGTCAG
GCTCAAGCAAGCTTCCGGGATGGCCTGCAGCTGGCCGCAGACATAGCCAGCCTCC
AGAACCGCATTGACTGGGGTCGAAGCCAGCTCCGGGGACTCCAAGAGAAACTCAA
GCAGCTGGAGCCTGGGGCTGCCTGACATGCGCGCAAAGAGGCAGGGCAGCGAGCA
CAGCTGTTCTCCGACATGGCTACGTGATCTCAGGCCTTCTTCCTTCACAATTAGC
TCTTGCCCCTACCCCACGCCAGCTAATGCCCCTTCTGTGTC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.