Search our product database

Search options:
Product name: hCENPO €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01938-1
Sigma Product ID: EHU019381
Species: Homo sapiens
Ensembl Gene ID: ENSG00000138092
Ensembl Transcript ID: ENST00000260662, ENST00000380834, ENST00000473706
Gene coordinates (GRCh38): 2:24793136-24822376
HGNC Alias: CENP-O, MGC11266
HGNC ID: HGNC:28152
HGNC Symbol: CENPO
NCBI gene: 79172
RefSeq mRNA: NM_001199803, NM_001322101, NM_024322
RefSeq ncRNA: NR_136182, NR_136183, NR_136184
Sequence:CATCCAGCACTTCCTGTTCAGTCTCTGCGAGTACCTGAATGCTTACTCTGGGAGG
AAGTACCAGGCAGACCGGCTTCAGAGTGACTTTGCAGCCCTCCTGACTGGGCCCT
TGCAGAGAAACCCACTGTGTAACTTGCTGTCATTTACTTACAAACTGGATCCAGG
GGGTCAGTCCTTCCCGTTCTGTGCTAGATTGCTGTATAAGGACCTCACAGCAACT
CTTCCCACTGACGTCACCGTGACATGTCAAGGAGTGGAAGTATTATCCACTTCAT
GGGAGGAGCAACGAGCATCTCATGAAACTCTGTTCTGTACGAAGCCCTTGCATCA
AGTGTTTGCCTCATTTACAAGAAAAGGAGAAAAGTTGGATATGAGTCTGGTCTCC
TAATAGATTGTTTTCACTGCACTGGGAGCACATCAGAGA
Product name: hCENPO €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01938-1
Sigma Product ID: EHU019381
Species: Homo sapiens
Ensembl Gene ID: ENSG00000138092
Ensembl Transcript ID: ENST00000260662, ENST00000380834, ENST00000473706
Gene coordinates (GRCh38): 2:24793136-24822376
HGNC Alias: CENP-O, MGC11266
HGNC ID: HGNC:28152
HGNC Symbol: CENPO
NCBI gene: 79172
RefSeq mRNA: NM_001199803, NM_001322101, NM_024322
RefSeq ncRNA: NR_136182, NR_136183, NR_136184
Sequence:CATCCAGCACTTCCTGTTCAGTCTCTGCGAGTACCTGAATGCTTACTCTGGGAGG
AAGTACCAGGCAGACCGGCTTCAGAGTGACTTTGCAGCCCTCCTGACTGGGCCCT
TGCAGAGAAACCCACTGTGTAACTTGCTGTCATTTACTTACAAACTGGATCCAGG
GGGTCAGTCCTTCCCGTTCTGTGCTAGATTGCTGTATAAGGACCTCACAGCAACT
CTTCCCACTGACGTCACCGTGACATGTCAAGGAGTGGAAGTATTATCCACTTCAT
GGGAGGAGCAACGAGCATCTCATGAAACTCTGTTCTGTACGAAGCCCTTGCATCA
AGTGTTTGCCTCATTTACAAGAAAAGGAGAAAAGTTGGATATGAGTCTGGTCTCC
TAATAGATTGTTTTCACTGCACTGGGAGCACATCAGAGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.