Search our product database

Search options:
Product name: hKIF11 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01993-1
Sigma Product ID: EHU019931
Species: Homo sapiens
Ensembl Gene ID: ENSG00000138160
Ensembl Transcript ID: ENST00000260731
Gene coordinates (GRCh38): 10:92593286-92655395
HGNC Alias: Eg5, HKSP, KNSL1, TRIP5
HGNC ID: HGNC:6388
HGNC Symbol: KIF11
NCBI gene: 3832
RefSeq mRNA: NM_004523
Sequence:TCCCCGTAACAAGAGAGGAGTGATAATTAAAGGTTTAGAAGAAATTACAGTACAC
AACAAGGATGAAGTCTATCAAATTTTAGAAAAGGGGGCAGCAAAAAGGACAACTG
CAGCTACTCTGATGAATGCATACTCTAGTCGTTCCCACTCAGTTTTCTCTGTTAC
AATACATATGAAAGAAACTACGATTGATGGAGAAGAGCTTGTTAAAATCGGAAAG
TTGAACTTGGTTGATCTTGCAGGAAGTGAAAACATTGGCCGTTCTGGAGCTGTTG
ATAAGAGAGCTCGGGAAGCTGGAAATATAAATCAATCCCTGTTGACTTTGGGAAG
GGTCATTACTGCCCTTGTAGAAAGAACACCTCATGTTCCTTATCGAGAATCTAAA
CTAACTAGAATCCTCCAGGATTCTCTTGGAGGGCGTACA
Product name: hKIF11 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-01993-1
Sigma Product ID: EHU019931
Species: Homo sapiens
Ensembl Gene ID: ENSG00000138160
Ensembl Transcript ID: ENST00000260731
Gene coordinates (GRCh38): 10:92593286-92655395
HGNC Alias: Eg5, HKSP, KNSL1, TRIP5
HGNC ID: HGNC:6388
HGNC Symbol: KIF11
NCBI gene: 3832
RefSeq mRNA: NM_004523
Sequence:TCCCCGTAACAAGAGAGGAGTGATAATTAAAGGTTTAGAAGAAATTACAGTACAC
AACAAGGATGAAGTCTATCAAATTTTAGAAAAGGGGGCAGCAAAAAGGACAACTG
CAGCTACTCTGATGAATGCATACTCTAGTCGTTCCCACTCAGTTTTCTCTGTTAC
AATACATATGAAAGAAACTACGATTGATGGAGAAGAGCTTGTTAAAATCGGAAAG
TTGAACTTGGTTGATCTTGCAGGAAGTGAAAACATTGGCCGTTCTGGAGCTGTTG
ATAAGAGAGCTCGGGAAGCTGGAAATATAAATCAATCCCTGTTGACTTTGGGAAG
GGTCATTACTGCCCTTGTAGAAAGAACACCTCATGTTCCTTATCGAGAATCTAAA
CTAACTAGAATCCTCCAGGATTCTCTTGGAGGGCGTACA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.