Search our product database

Search options:
Product name: hIRS1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02033-1
Sigma Product ID: EHU020331
Species: Homo sapiens
Ensembl Gene ID: ENSG00000169047
Ensembl Transcript ID: ENST00000305123
Gene coordinates (GRCh38): 2:226731317-226799759
HGNC Alias: HIRS-1
HGNC ID: HGNC:6125
HGNC Symbol: IRS1
NCBI gene: 3667
RefSeq mRNA: NM_005544
Sequence:GACCCCAATGGCTACATGATGATGTCCCCCAGCGGTGGCTGCTCTCCTGACATTG
GAGGTGGCCCCAGCAGCAGCAGCAGCAGCAGCAACGCCGTCCCTTCCGGGACCAG
CTATGGAAAGCTGTGGACAAACGGGGTAGGGGGCCACCACTCTCATGTCTTGCCT
CACCCCAAACCCCCAGTGGAGAGCAGCGGTGGTAAGCTCTTACCTTGCACAGGTG
ACTACATGAACATGTCACCAGTGGGGGACTCCAACACCAGCAGCCCCTCCGACTG
CTACTACGGCCCTGAGGACCCCCAGCACAAGCCAGTCCTCTCCTACTACTCATTG
CCAAGATCCTTTAAGCACACCCAGCGCCCCGGGGAGCCGGAGGAGGGTGCCCGGC
ATCAGCACCTCCGCCTTTCCACTAGCTCTGGTCGCCTTC
Product name: hIRS1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02033-1
Sigma Product ID: EHU020331
Species: Homo sapiens
Ensembl Gene ID: ENSG00000169047
Ensembl Transcript ID: ENST00000305123
Gene coordinates (GRCh38): 2:226731317-226799759
HGNC Alias: HIRS-1
HGNC ID: HGNC:6125
HGNC Symbol: IRS1
NCBI gene: 3667
RefSeq mRNA: NM_005544
Sequence:GACCCCAATGGCTACATGATGATGTCCCCCAGCGGTGGCTGCTCTCCTGACATTG
GAGGTGGCCCCAGCAGCAGCAGCAGCAGCAGCAACGCCGTCCCTTCCGGGACCAG
CTATGGAAAGCTGTGGACAAACGGGGTAGGGGGCCACCACTCTCATGTCTTGCCT
CACCCCAAACCCCCAGTGGAGAGCAGCGGTGGTAAGCTCTTACCTTGCACAGGTG
ACTACATGAACATGTCACCAGTGGGGGACTCCAACACCAGCAGCCCCTCCGACTG
CTACTACGGCCCTGAGGACCCCCAGCACAAGCCAGTCCTCTCCTACTACTCATTG
CCAAGATCCTTTAAGCACACCCAGCGCCCCGGGGAGCCGGAGGAGGGTGCCCGGC
ATCAGCACCTCCGCCTTTCCACTAGCTCTGGTCGCCTTC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.