Search our product database

Search options:
Product name: hCEP76 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02035-1
Sigma Product ID: EHU020351
Species: Homo sapiens
Ensembl Gene ID: ENSG00000101624
Ensembl Transcript ID: ENST00000262127, ENST00000423709, ENST00000589490, ENST00000590143
Gene coordinates (GRCh38): 18:12661833-12702777
HGNC Alias: C18orf9, FLJ12542, HsT1705
HGNC ID: HGNC:25727
HGNC Symbol: CEP76
NCBI gene: 79959
RefSeq mRNA: NM_001271989, NM_024899
RefSeq ncRNA: NR_073537
Sequence:ACAGCCCAAACCACTGTACCCATATCGAACAATTGGTTGTGTTTTCAACCATCAG
ATGTTCCTGGGAAATTGTCAACCCTCTGATGCAGTAGAAACCTGTGTATTTGATT
TGAACGATGAATCCAAATGGAAACCCATGAGTGAGGAAGCAATTAAATCTGTGTG
TGCTCCTGGAGCTACAACATCCCTTCCTCCCTTTCCACCTCTGTGTGCATCCACA
ATTGACGCGTCAGTAACAAGTAATGAAATTGAAATGCAGCTGAGGCTCCTGGTGT
CAGAACACAGGAAGGATCTTGGCCTCACTACTGTTTGGGAAGACCAGCTCTCCTA
CCTTTTATCACCAGCTTTGGCTTCTTATGAATTTGAGCGTACAACAAGTATATCA
GCAGGCAATGAAGAATTTCAAGATGCCATAAGAAGGGC
Product name: hCEP76 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02035-1
Sigma Product ID: EHU020351
Species: Homo sapiens
Ensembl Gene ID: ENSG00000101624
Ensembl Transcript ID: ENST00000262127, ENST00000423709, ENST00000589490, ENST00000590143
Gene coordinates (GRCh38): 18:12661833-12702777
HGNC Alias: C18orf9, FLJ12542, HsT1705
HGNC ID: HGNC:25727
HGNC Symbol: CEP76
NCBI gene: 79959
RefSeq mRNA: NM_001271989, NM_024899
RefSeq ncRNA: NR_073537
Sequence:ACAGCCCAAACCACTGTACCCATATCGAACAATTGGTTGTGTTTTCAACCATCAG
ATGTTCCTGGGAAATTGTCAACCCTCTGATGCAGTAGAAACCTGTGTATTTGATT
TGAACGATGAATCCAAATGGAAACCCATGAGTGAGGAAGCAATTAAATCTGTGTG
TGCTCCTGGAGCTACAACATCCCTTCCTCCCTTTCCACCTCTGTGTGCATCCACA
ATTGACGCGTCAGTAACAAGTAATGAAATTGAAATGCAGCTGAGGCTCCTGGTGT
CAGAACACAGGAAGGATCTTGGCCTCACTACTGTTTGGGAAGACCAGCTCTCCTA
CCTTTTATCACCAGCTTTGGCTTCTTATGAATTTGAGCGTACAACAAGTATATCA
GCAGGCAATGAAGAATTTCAAGATGCCATAAGAAGGGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.