Search our product database

Search options:
Product name: hFLT3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02069-1
Sigma Product ID: EHU020691
Species: Homo sapiens
Ensembl Gene ID: ENSG00000122025
Ensembl Transcript ID: ENST00000241453, ENST00000380987
Gene coordinates (GRCh38): 13:28003274-28100592
HGNC Alias: CD135, FLK2, STK1
HGNC ID: HGNC:3765
HGNC Symbol: FLT3
NCBI gene: 2322
RefSeq mRNA: NM_004119
RefSeq ncRNA: NR_130706
Sequence:CCCACTTTCCAATCACATCCAAATTCCAGCATGCCTGGTTCAAGAGAAGTTCAGA
TACACCCGGACTCGGATCAAATCTCAGGGCTTCATGGGAATTCATTTCACTCTGA
AGATGAAATTGAATATGAAAACCAAAAAAGGCTGGAAGAAGAGGAGGACTTGAAT
GTGCTTACATTTGAAGATCTTCTTTGCTTTGCATATCAAGTTGCCAAAGGAATGG
AATTTCTGGAATTTAAGTCGTGTGTTCACAGAGACCTGGCCGCCAGGAACGTGCT
TGTCACCCACGGGAAAGTGGTGAAGATATGTGACTTTGGATTGGCTCGAGATATC
ATGAGTGATTCCAACTATGTTGTCAGGGGCAATGCCCGTCTGCCTGTAAAATGGA
TGGCCCCCGAAAGCCTGTTTGAAGGCATCTACACCATTAAGAGTGATGTCTGGTC
ATATGGAATATTACTGTGGGAAATCTTCTCACTTGGTGTGAATCCTTACCCTGGC
ATTCC
Product name: hFLT3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02069-1
Sigma Product ID: EHU020691
Species: Homo sapiens
Ensembl Gene ID: ENSG00000122025
Ensembl Transcript ID: ENST00000241453, ENST00000380987
Gene coordinates (GRCh38): 13:28003274-28100592
HGNC Alias: CD135, FLK2, STK1
HGNC ID: HGNC:3765
HGNC Symbol: FLT3
NCBI gene: 2322
RefSeq mRNA: NM_004119
RefSeq ncRNA: NR_130706
Sequence:CCCACTTTCCAATCACATCCAAATTCCAGCATGCCTGGTTCAAGAGAAGTTCAGA
TACACCCGGACTCGGATCAAATCTCAGGGCTTCATGGGAATTCATTTCACTCTGA
AGATGAAATTGAATATGAAAACCAAAAAAGGCTGGAAGAAGAGGAGGACTTGAAT
GTGCTTACATTTGAAGATCTTCTTTGCTTTGCATATCAAGTTGCCAAAGGAATGG
AATTTCTGGAATTTAAGTCGTGTGTTCACAGAGACCTGGCCGCCAGGAACGTGCT
TGTCACCCACGGGAAAGTGGTGAAGATATGTGACTTTGGATTGGCTCGAGATATC
ATGAGTGATTCCAACTATGTTGTCAGGGGCAATGCCCGTCTGCCTGTAAAATGGA
TGGCCCCCGAAAGCCTGTTTGAAGGCATCTACACCATTAAGAGTGATGTCTGGTC
ATATGGAATATTACTGTGGGAAATCTTCTCACTTGGTGTGAATCCTTACCCTGGC
ATTCC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.