Search our product database

Search options:
Product name: hTPP1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02236-1
Sigma Product ID: EHU022361
Species: Homo sapiens
Ensembl Gene ID: ENSG00000166340
Ensembl Transcript ID: ENST00000299427, ENST00000524611, ENST00000533371, ENST00000642892, ENST00000643342, ENST00000643439, ENST00000643479, ENST00000643516, ENST00000644218, ENST00000644683, ENST00000644810, ENST00000644831, ENST00000644933, ENST00000645285, ENST00000645331, ENST00000645620, ENST00000646691, ENST00000646777, ENST00000647016, ENST00000647152, ENST00000647209, ENST00000647346
Gene coordinates (GRCh38): 11:6612763-6619485
HGNC Alias: CLN2, SCAR7
HGNC ID: HGNC:2073
HGNC Symbol: TPP1
NCBI gene: 1200
RefSeq mRNA: NM_000391
Sequence:AACTTCCCAGCTTTGCTGAAGACTCTACTCAACCCCTGACCCTTTCCTATCAGGA
GAGATGGCTTGTCCCCTGCCCTGAAGCTGGCAGTTCAGTCCCTTATTCTGCCCTG
TTGGAAGCCCTGCTGAACCCTCAACTATTGACTGCTGCAGACAGCTTATCTCCCT
AACCCTGAAATGCTGTGAGCTTGACTTGACTCCCAACCCTACCATGCTCCATCAT
ACTCAGGTCTCCCTACTCCTGCCTTAGATTCCTCAATAAGATGCTGTAACTAGCA
TTTTTTGAATGCCTCTCCCTCCGCATCTCATCTTTCTCTTTTCAATCAGGCTTTT
CCAAAGGGTTGTATACAGACTCTGTGCACTATTTCACTTGATATTCATTCCCCAA
TTCACTGCAAGGAGACCTCTACTGTCACCGTTTACTCTTTCCTACCCTGACATCC
AGAAACAATGGCCTCCAGTGCATACTTCTCAATCTTTGCTTTATGGCCTTTCCAT
C
Product name: hTPP1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02236-1
Sigma Product ID: EHU022361
Species: Homo sapiens
Ensembl Gene ID: ENSG00000166340
Ensembl Transcript ID: ENST00000299427, ENST00000524611, ENST00000533371, ENST00000642892, ENST00000643342, ENST00000643439, ENST00000643479, ENST00000643516, ENST00000644218, ENST00000644683, ENST00000644810, ENST00000644831, ENST00000644933, ENST00000645285, ENST00000645331, ENST00000645620, ENST00000646691, ENST00000646777, ENST00000647016, ENST00000647152, ENST00000647209, ENST00000647346
Gene coordinates (GRCh38): 11:6612763-6619485
HGNC Alias: CLN2, SCAR7
HGNC ID: HGNC:2073
HGNC Symbol: TPP1
NCBI gene: 1200
RefSeq mRNA: NM_000391
Sequence:AACTTCCCAGCTTTGCTGAAGACTCTACTCAACCCCTGACCCTTTCCTATCAGGA
GAGATGGCTTGTCCCCTGCCCTGAAGCTGGCAGTTCAGTCCCTTATTCTGCCCTG
TTGGAAGCCCTGCTGAACCCTCAACTATTGACTGCTGCAGACAGCTTATCTCCCT
AACCCTGAAATGCTGTGAGCTTGACTTGACTCCCAACCCTACCATGCTCCATCAT
ACTCAGGTCTCCCTACTCCTGCCTTAGATTCCTCAATAAGATGCTGTAACTAGCA
TTTTTTGAATGCCTCTCCCTCCGCATCTCATCTTTCTCTTTTCAATCAGGCTTTT
CCAAAGGGTTGTATACAGACTCTGTGCACTATTTCACTTGATATTCATTCCCCAA
TTCACTGCAAGGAGACCTCTACTGTCACCGTTTACTCTTTCCTACCCTGACATCC
AGAAACAATGGCCTCCAGTGCATACTTCTCAATCTTTGCTTTATGGCCTTTCCAT
C

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.