Search our product database

Search options:
Product name: hFGF12 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02307-1
Sigma Product ID: EHU023071
Species: Homo sapiens
Ensembl Gene ID: ENSG00000114279
Ensembl Transcript ID: ENST00000454309
Gene coordinates (GRCh38): 3:192139395-192767764
HGNC Alias: FGF12B, FHF1
HGNC ID: HGNC:3668
HGNC Symbol: FGF12
NCBI gene: 2257
RefSeq mRNA: NM_021032
Sequence:TTTCGATACTGCAGCCTCCTCAAATTTTAGCACTGCCTCCCCGCGACTGCCCTTT
CCCTGGCCGCCCAGGTCCTGCCCTCGCCCCGGCGGAGCGCAAGCCGGAGGGCGCA
GTAGAGGCTGGGGCCTGAGGCCCTCGCTGAGCAGCTATGGCTGCGGCGATAGCCA
GCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAGTCCAACAGCGACCGAGTGTC
GGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGACGGGCGCTCCCTGTGCGAGAGG
CACGTCCTCGGGGTGTTCAGCAAAGTGCGCTTCTGCAGCGGCCGCAAGAGGCCGG
TGAGGCGGAGACCAGAACCCCAGCTCAAAGGGATTGTGACAAGGTTATTCAGCCA
GCAGGGATACTTCCTGCAGATGCACCCAGATGGTACC
Product name: hFGF12 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02307-1
Sigma Product ID: EHU023071
Species: Homo sapiens
Ensembl Gene ID: ENSG00000114279
Ensembl Transcript ID: ENST00000454309
Gene coordinates (GRCh38): 3:192139395-192767764
HGNC Alias: FGF12B, FHF1
HGNC ID: HGNC:3668
HGNC Symbol: FGF12
NCBI gene: 2257
RefSeq mRNA: NM_021032
Sequence:TTTCGATACTGCAGCCTCCTCAAATTTTAGCACTGCCTCCCCGCGACTGCCCTTT
CCCTGGCCGCCCAGGTCCTGCCCTCGCCCCGGCGGAGCGCAAGCCGGAGGGCGCA
GTAGAGGCTGGGGCCTGAGGCCCTCGCTGAGCAGCTATGGCTGCGGCGATAGCCA
GCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAGTCCAACAGCGACCGAGTGTC
GGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGACGGGCGCTCCCTGTGCGAGAGG
CACGTCCTCGGGGTGTTCAGCAAAGTGCGCTTCTGCAGCGGCCGCAAGAGGCCGG
TGAGGCGGAGACCAGAACCCCAGCTCAAAGGGATTGTGACAAGGTTATTCAGCCA
GCAGGGATACTTCCTGCAGATGCACCCAGATGGTACC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.