Search our product database

Search options:
Product name: hCEP192 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02671-1
Sigma Product ID: EHU026711
Species: Homo sapiens
Ensembl Gene ID: ENSG00000101639
Ensembl Transcript ID: ENST00000325971, ENST00000430049, ENST00000506447, ENST00000510237, ENST00000511820, ENST00000513432, ENST00000589993
Gene coordinates (GRCh38): 18:12991362-13125052
HGNC Alias: FLJ10352, KIAA1569, PPP1R62
HGNC ID: HGNC:25515
HGNC Symbol: CEP192
NCBI gene: 55125
RefSeq mRNA: NM_032142
Sequence:TATTTGTGCAGCCATTTGGACCTCAGTATGAGGTAGTGTTAAAAGGCGAAGTCAT
TTCTTCAGGAAGTAAACCTCTGTCACCTGGACCTTGCTTAGATATTCCATCGATT
TTGTCCAACAAACAATTTCTGGCTTGGGGAGGAGTCCCTCTAGGTAGAACACAGC
TTCAGAAACTAGCTTTAAGAAATAATTCTGCATCTACAACTCAACATTTACGACT
GCTTATTAGAGGACAAGATCAGGACTGCTTTCAGCTTCAGAACACTTTTGGTTCA
GAACAGCGATTGACCAGTAACTGTGAGATCAGAATTCACCCAAAGGAAGACATTT
TCATCTCTGTATTATTTGCACCTACTCGATTATCTTGCATGTTGGCTAGACTAGA
AATCAAACAACTTGGAAATCGATCACAACCAGG
Product name: hCEP192 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02671-1
Sigma Product ID: EHU026711
Species: Homo sapiens
Ensembl Gene ID: ENSG00000101639
Ensembl Transcript ID: ENST00000325971, ENST00000430049, ENST00000506447, ENST00000510237, ENST00000511820, ENST00000513432, ENST00000589993
Gene coordinates (GRCh38): 18:12991362-13125052
HGNC Alias: FLJ10352, KIAA1569, PPP1R62
HGNC ID: HGNC:25515
HGNC Symbol: CEP192
NCBI gene: 55125
RefSeq mRNA: NM_032142
Sequence:TATTTGTGCAGCCATTTGGACCTCAGTATGAGGTAGTGTTAAAAGGCGAAGTCAT
TTCTTCAGGAAGTAAACCTCTGTCACCTGGACCTTGCTTAGATATTCCATCGATT
TTGTCCAACAAACAATTTCTGGCTTGGGGAGGAGTCCCTCTAGGTAGAACACAGC
TTCAGAAACTAGCTTTAAGAAATAATTCTGCATCTACAACTCAACATTTACGACT
GCTTATTAGAGGACAAGATCAGGACTGCTTTCAGCTTCAGAACACTTTTGGTTCA
GAACAGCGATTGACCAGTAACTGTGAGATCAGAATTCACCCAAAGGAAGACATTT
TCATCTCTGTATTATTTGCACCTACTCGATTATCTTGCATGTTGGCTAGACTAGA
AATCAAACAACTTGGAAATCGATCACAACCAGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.