Search our product database

Search options:
Product name: hPAK2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02672-1
Sigma Product ID: EHU026721
Species: Homo sapiens
Ensembl Gene ID: ENSG00000180370
Ensembl Transcript ID: ENST00000327134
Gene coordinates (GRCh38): 3:196739857-196832647
HGNC Alias: PAK65, PAKgamma
HGNC ID: HGNC:8591
HGNC Symbol: PAK2
NCBI gene: 5062
RefSeq mRNA: NM_002577
Sequence:ACCCTTTGTCAGCCAATCACAGTTTGAAACCTTTGCCCTCTGTTCCAGAAGAGAA
AAAGCCCAGGCATAAAATCATCTCCATATTCTCAGGCACAGAGAAAGGAAGTAAA
AAGAAAGAAAAGGAACGGCCAGAAATTTCTCCTCCATCTGATTTTGAGCACACCA
TCCATGTTGGCTTTGATGCTGTTACTGGAGAATTCACTGGCATGCCAGAACAGTG
GGCTCGATTACTACAGACCTCCAATATCACCAAACTAGAGCAAAAGAAGAATCCT
CAGGCTGTGCTGGATGTCCTAAAGTTCTACGACTCCAACACAGTGAAGCAGAAAT
ATCTGAGCTTTACTCCTCCTGAGAAAGATGGCTTTCCTTCTGGAACACCAGCACT
GAATGCCAAGGGAACAGAAGCACCCGCAGTAGT
Product name: hPAK2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02672-1
Sigma Product ID: EHU026721
Species: Homo sapiens
Ensembl Gene ID: ENSG00000180370
Ensembl Transcript ID: ENST00000327134
Gene coordinates (GRCh38): 3:196739857-196832647
HGNC Alias: PAK65, PAKgamma
HGNC ID: HGNC:8591
HGNC Symbol: PAK2
NCBI gene: 5062
RefSeq mRNA: NM_002577
Sequence:ACCCTTTGTCAGCCAATCACAGTTTGAAACCTTTGCCCTCTGTTCCAGAAGAGAA
AAAGCCCAGGCATAAAATCATCTCCATATTCTCAGGCACAGAGAAAGGAAGTAAA
AAGAAAGAAAAGGAACGGCCAGAAATTTCTCCTCCATCTGATTTTGAGCACACCA
TCCATGTTGGCTTTGATGCTGTTACTGGAGAATTCACTGGCATGCCAGAACAGTG
GGCTCGATTACTACAGACCTCCAATATCACCAAACTAGAGCAAAAGAAGAATCCT
CAGGCTGTGCTGGATGTCCTAAAGTTCTACGACTCCAACACAGTGAAGCAGAAAT
ATCTGAGCTTTACTCCTCCTGAGAAAGATGGCTTTCCTTCTGGAACACCAGCACT
GAATGCCAAGGGAACAGAAGCACCCGCAGTAGT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.