Search our product database

Search options:
Product name: hCLASP1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02894-1
Sigma Product ID: EHU028941
Species: Homo sapiens
Ensembl Gene ID: ENSG00000074054
Ensembl Transcript ID: ENST00000263710, ENST00000397587, ENST00000409078, ENST00000455322, ENST00000541377, ENST00000646274
Gene coordinates (GRCh38): 2:121337776-121649587
HGNC Alias: KIAA0622, MAST1
HGNC ID: HGNC:17088
HGNC Symbol: CLASP1
NCBI gene: 23332
RefSeq mRNA: NM_001142273, NM_001142274, NM_001207051, NM_015282
Sequence:ATGGGACAGAATGCTTGGAGGCTTCAAACACAAGAATTTCCGTACTCGAGAAGGC
ATCTGTCTCTGCCTTATAGCAACACTCAATGCCTCTGGAGCACAGACTTTAACAC
TAAGCAAGATTGTGCCACATATATGCAACTTACTTGGAGATCCAAACAGCCAGGT
TCGAGATGCAGCAATAAACAGCTTAGTGGAAATTTACAGACATGTAGGAGAACGT
GTGAGGGCAGATCTCAGTAAAAAAGGATTGCCACAGTCCCGGTTGAATGTAATTT
TTACAAAATTTGATGAAGTCCAGAAATCTGGAAACATGATACAATCTGCAAATGA
TAAAAATTTCGACGATGAAGATTCTGTGGATGGTAACAGACCTTCCTCTGCTAGT
TCTACATCATCCAAGGCTCCACCAAGTTCTC
Product name: hCLASP1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02894-1
Sigma Product ID: EHU028941
Species: Homo sapiens
Ensembl Gene ID: ENSG00000074054
Ensembl Transcript ID: ENST00000263710, ENST00000397587, ENST00000409078, ENST00000455322, ENST00000541377, ENST00000646274
Gene coordinates (GRCh38): 2:121337776-121649587
HGNC Alias: KIAA0622, MAST1
HGNC ID: HGNC:17088
HGNC Symbol: CLASP1
NCBI gene: 23332
RefSeq mRNA: NM_001142273, NM_001142274, NM_001207051, NM_015282
Sequence:ATGGGACAGAATGCTTGGAGGCTTCAAACACAAGAATTTCCGTACTCGAGAAGGC
ATCTGTCTCTGCCTTATAGCAACACTCAATGCCTCTGGAGCACAGACTTTAACAC
TAAGCAAGATTGTGCCACATATATGCAACTTACTTGGAGATCCAAACAGCCAGGT
TCGAGATGCAGCAATAAACAGCTTAGTGGAAATTTACAGACATGTAGGAGAACGT
GTGAGGGCAGATCTCAGTAAAAAAGGATTGCCACAGTCCCGGTTGAATGTAATTT
TTACAAAATTTGATGAAGTCCAGAAATCTGGAAACATGATACAATCTGCAAATGA
TAAAAATTTCGACGATGAAGATTCTGTGGATGGTAACAGACCTTCCTCTGCTAGT
TCTACATCATCCAAGGCTCCACCAAGTTCTC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.