Search our product database

Search options:
Product name: hFANCD2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02926-1
Sigma Product ID: EHU029261
Species: Homo sapiens
Ensembl Gene ID: ENSG00000144554
Ensembl Transcript ID: ENST00000287647, ENST00000383807, ENST00000419585
Gene coordinates (GRCh38): 3:10026414-10101930
HGNC Alias: FACD, FAD, FA-D2, FANCD
HGNC ID: HGNC:3585
HGNC Symbol: FANCD2
NCBI gene: 2177
RefSeq mRNA: NM_001018115, NM_001319984, NM_033084
Sequence:TCCGACTTGACCCAAACTTCCTATTGAAGGTTCGCCAGTTGGTGATGGATAAGTT
GTCGTCTATTAGATTGGAGGATTTACCTGTGATAATAAAGTTCATTCTTCATTCC
GTAACAGCCATGGATACACTTGAGGTAATTTCTGAGCTTCGGGAGAAGTTGGATC
TGCAGCATTGTGTTTTGCCATCACGGTTACAGGCTTCCCAAGTAAAGTTGAAAAG
TAAAGGACGAGCAAGTTCCTCAGGAAATCAAGAAAGCAGCGGTCAGAGCTGTATT
ATTCTCCTCTTTGATGTAATAAAGTCAGCTATTAGATATGAGAAAACCATTTCAG
AAGCCTGGATTAAGGCAATTGAAAACACTGCCTCAGTATCTGAACACAAGGTGTT
TGACCTGGTGATGCTTTTCATCATCTATAGCACCAATACTCAGACAAAGAAGTAC
ATTGACAGGGTGCTAAGAAATAAGATTCGATCAGGCTGCATT
Product name: hFANCD2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02926-1
Sigma Product ID: EHU029261
Species: Homo sapiens
Ensembl Gene ID: ENSG00000144554
Ensembl Transcript ID: ENST00000287647, ENST00000383807, ENST00000419585
Gene coordinates (GRCh38): 3:10026414-10101930
HGNC Alias: FACD, FAD, FA-D2, FANCD
HGNC ID: HGNC:3585
HGNC Symbol: FANCD2
NCBI gene: 2177
RefSeq mRNA: NM_001018115, NM_001319984, NM_033084
Sequence:TCCGACTTGACCCAAACTTCCTATTGAAGGTTCGCCAGTTGGTGATGGATAAGTT
GTCGTCTATTAGATTGGAGGATTTACCTGTGATAATAAAGTTCATTCTTCATTCC
GTAACAGCCATGGATACACTTGAGGTAATTTCTGAGCTTCGGGAGAAGTTGGATC
TGCAGCATTGTGTTTTGCCATCACGGTTACAGGCTTCCCAAGTAAAGTTGAAAAG
TAAAGGACGAGCAAGTTCCTCAGGAAATCAAGAAAGCAGCGGTCAGAGCTGTATT
ATTCTCCTCTTTGATGTAATAAAGTCAGCTATTAGATATGAGAAAACCATTTCAG
AAGCCTGGATTAAGGCAATTGAAAACACTGCCTCAGTATCTGAACACAAGGTGTT
TGACCTGGTGATGCTTTTCATCATCTATAGCACCAATACTCAGACAAAGAAGTAC
ATTGACAGGGTGCTAAGAAATAAGATTCGATCAGGCTGCATT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.