Search our product database

Search options:
Product name: hMME €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02945-1
Sigma Product ID: EHU029451
Species: Homo sapiens
Ensembl Gene ID: ENSG00000196549
Ensembl Transcript ID: ENST00000360490, ENST00000460393, ENST00000462745, ENST00000492661, ENST00000493237, ENST00000615825
Gene coordinates (GRCh38): 3:155024124-155183729
HGNC Alias: CALLA, CD10, NEP
HGNC ID: HGNC:7154
HGNC Symbol: MME
NCBI gene: 4311
RefSeq mRNA: NM_000902, NM_001354642, NM_001354643, NM_007287, NM_007288, NM_007289
Sequence:CCATCGATGAAAACCAGCTTGCTTTGGAAATGAATAAAGTTATGGAATTGGAAAA
AGAAATTGCCAATGCTACGGCTAAACCTGAAGATCGAAATGATCCAATGCTTCTG
TATAACAAGATGACATTGGCCCAGATCCAAAATAACTTTTCACTAGAGATCAATG
GGAAGCCATTCAGCTGGTTGAATTTCACAAATGAAATCATGTCAACTGTGAATAT
TAGTATTACAAATGAGGAAGATGTGGTTGTTTATGCTCCAGAATATTTAACCAAA
CTTAAGCCCATTCTTACCAAATATTCTGCCAGAGATCTTCAAAATTTAATGTCCT
GGAGATTCATAATGGATCTTGTAAGCAGCCTCAGCCGAACCTACAAGGAGTCCAG
AAATGCTTTCCGCAAGGCCCTTTATGGTACA
Product name: hMME €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02945-1
Sigma Product ID: EHU029451
Species: Homo sapiens
Ensembl Gene ID: ENSG00000196549
Ensembl Transcript ID: ENST00000360490, ENST00000460393, ENST00000462745, ENST00000492661, ENST00000493237, ENST00000615825
Gene coordinates (GRCh38): 3:155024124-155183729
HGNC Alias: CALLA, CD10, NEP
HGNC ID: HGNC:7154
HGNC Symbol: MME
NCBI gene: 4311
RefSeq mRNA: NM_000902, NM_001354642, NM_001354643, NM_007287, NM_007288, NM_007289
Sequence:CCATCGATGAAAACCAGCTTGCTTTGGAAATGAATAAAGTTATGGAATTGGAAAA
AGAAATTGCCAATGCTACGGCTAAACCTGAAGATCGAAATGATCCAATGCTTCTG
TATAACAAGATGACATTGGCCCAGATCCAAAATAACTTTTCACTAGAGATCAATG
GGAAGCCATTCAGCTGGTTGAATTTCACAAATGAAATCATGTCAACTGTGAATAT
TAGTATTACAAATGAGGAAGATGTGGTTGTTTATGCTCCAGAATATTTAACCAAA
CTTAAGCCCATTCTTACCAAATATTCTGCCAGAGATCTTCAAAATTTAATGTCCT
GGAGATTCATAATGGATCTTGTAAGCAGCCTCAGCCGAACCTACAAGGAGTCCAG
AAATGCTTTCCGCAAGGCCCTTTATGGTACA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.