Search our product database

Search options:
Product name: hANAPC1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02999-1
Sigma Product ID: EHU029991
Species: Homo sapiens
Ensembl Gene ID: ENSG00000153107
Ensembl Transcript ID: ENST00000341068, ENST00000427997
Gene coordinates (GRCh38): 2:111611639-111884690
HGNC Alias: APC1, MCPR, TSG24
HGNC ID: HGNC:19988
HGNC Symbol: ANAPC1
NCBI gene: 64682
RefSeq mRNA: NM_022662
Sequence:TGTGCACAATTGATCCAGGTCAAACAGGATTTATGCATCATCCATCATTTTTTAC
GTCTGAGCCACCAAGTATTTATCAGTGGGTGAGTTCTTGTCTGAAGGGTGAAGGA
ATGCCACCTTATCCTTACCTCCCTGGAATCTGTGAAAGAAGCAGACTTGTAGTCT
TGAGTATTGCACTGTACATACTTGGTGATGAGAGCTTGGTTTCTGATGAATCCTC
ACAGTATTTAACCAGAATAACTATAGCCCCCCAGAAGTTGCAAGTAGAACAAGAG
GAAAACAGGTTTAGTTTCAGGCATTCTACATCTGTTTCTAGTCTAGCTGAAAGAT
TGGTTGTCTGGATGACTAATGTAGGATTCACTTTAAGAGATTTGGAAACTCTTCC
CTTTGGAATTGCTCTTCCCATCAGAGATGC
Product name: hANAPC1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02999-1
Sigma Product ID: EHU029991
Species: Homo sapiens
Ensembl Gene ID: ENSG00000153107
Ensembl Transcript ID: ENST00000341068, ENST00000427997
Gene coordinates (GRCh38): 2:111611639-111884690
HGNC Alias: APC1, MCPR, TSG24
HGNC ID: HGNC:19988
HGNC Symbol: ANAPC1
NCBI gene: 64682
RefSeq mRNA: NM_022662
Sequence:TGTGCACAATTGATCCAGGTCAAACAGGATTTATGCATCATCCATCATTTTTTAC
GTCTGAGCCACCAAGTATTTATCAGTGGGTGAGTTCTTGTCTGAAGGGTGAAGGA
ATGCCACCTTATCCTTACCTCCCTGGAATCTGTGAAAGAAGCAGACTTGTAGTCT
TGAGTATTGCACTGTACATACTTGGTGATGAGAGCTTGGTTTCTGATGAATCCTC
ACAGTATTTAACCAGAATAACTATAGCCCCCCAGAAGTTGCAAGTAGAACAAGAG
GAAAACAGGTTTAGTTTCAGGCATTCTACATCTGTTTCTAGTCTAGCTGAAAGAT
TGGTTGTCTGGATGACTAATGTAGGATTCACTTTAAGAGATTTGGAAACTCTTCC
CTTTGGAATTGCTCTTCCCATCAGAGATGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.