Search our product database

Search options:
Product name: hMECP2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03027-1
Sigma Product ID: EHU030271
Species: Homo sapiens
Ensembl Gene ID: ENSG00000169057
Ensembl Transcript ID: ENST00000303391
Gene coordinates (GRCh38): X:154021573-154137103
HGNC Alias: MRX16, MRX79, RTT
HGNC ID: HGNC:6990
HGNC Symbol: MECP2
NCBI gene: 4204
RefSeq mRNA: NM_001316337, NM_004992
Sequence:CCGTGACCGAGAGAGTTAGCTGACTTTACACGGAGCGGATTGCAAAGCAAACCAA
CAAGAATAAAGGCAGCTGTTGTCTCTTCTCCTTATGGGTAGGGCTCTGACAAAGC
TTCCCGATTAACTGAAATAAAAAATATTTTTTTTTCTTTCAGTAAACTTAGAGTT
TCGTGGCTTCAGGGTGGGAGTAGTTGGAGCATTGGGGATGTTTTTCTTACCGACA
AGCACAGTCAGGTTGAAGACCTAACCAGGGCCAGAAGTAGCTTTGCACTTTTCTA
AACTAGGCTCCTTCAACAAGGCTTGCTGCAGATACTACTGACCAGACAAGCTGTT
GACCAGGCACCTCCCCTCCCGCCCAAACCTTTCCCCCATGTGGTCGTTAGAGACA
GAGCGACAGAGCAGTTGAGAGGACACTCCC
Product name: hMECP2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03027-1
Sigma Product ID: EHU030271
Species: Homo sapiens
Ensembl Gene ID: ENSG00000169057
Ensembl Transcript ID: ENST00000303391
Gene coordinates (GRCh38): X:154021573-154137103
HGNC Alias: MRX16, MRX79, RTT
HGNC ID: HGNC:6990
HGNC Symbol: MECP2
NCBI gene: 4204
RefSeq mRNA: NM_001316337, NM_004992
Sequence:CCGTGACCGAGAGAGTTAGCTGACTTTACACGGAGCGGATTGCAAAGCAAACCAA
CAAGAATAAAGGCAGCTGTTGTCTCTTCTCCTTATGGGTAGGGCTCTGACAAAGC
TTCCCGATTAACTGAAATAAAAAATATTTTTTTTTCTTTCAGTAAACTTAGAGTT
TCGTGGCTTCAGGGTGGGAGTAGTTGGAGCATTGGGGATGTTTTTCTTACCGACA
AGCACAGTCAGGTTGAAGACCTAACCAGGGCCAGAAGTAGCTTTGCACTTTTCTA
AACTAGGCTCCTTCAACAAGGCTTGCTGCAGATACTACTGACCAGACAAGCTGTT
GACCAGGCACCTCCCCTCCCGCCCAAACCTTTCCCCCATGTGGTCGTTAGAGACA
GAGCGACAGAGCAGTTGAGAGGACACTCCC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.