Search our product database

Search options:
Product name: hSNAI1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03043-1
Sigma Product ID: EHU030431
Species: Homo sapiens
Ensembl Gene ID: ENSG00000124216
Ensembl Transcript ID: ENST00000244050
Gene coordinates (GRCh38): 20:49982999-49988886
HGNC Alias: SLUGH2, SNA, SNAH, SNAIL, SNAIL1
HGNC ID: HGNC:11128
HGNC Symbol: SNAI1
NCBI gene: 6615
RefSeq mRNA: NM_005985
Sequence:TTTACCTTCCAGCAGCCCTACGACCAGGCCCACCTGCTGGCAGCCATCCCACCTC
CGGAGATCCTCAACCCCACCGCCTCGCTGCCAATGCTCATCTGGGACTCTGTCCT
GGCGCCCCAAGCCCAGCCAATTGCCTGGGCCTCCCTTCGGCTCCAGGAGAGTCCC
AGGGTGGCAGAGCTGACCTCCCTGTCAGATGAGGACAGTGGGAAAGGCTCCCAGC
CCCCCAGCCCACCCTCACCGGCTCCTTCGTCCTTCTCCTCTACTTCAGTCTCTTC
CTTGGAGGCCGAGGCCTATGCTGCCTTCCCAGGCTTGGGCCAAGTGCCCAAGCAG
CTGGCCCAGCTCTCTGAGGCCAAGGATCTCCAGGCTCGAAAGGCCTTCAACTGCA
AATACTGCAACAAGGAATACCTCAGCCTGG
Product name: hSNAI1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03043-1
Sigma Product ID: EHU030431
Species: Homo sapiens
Ensembl Gene ID: ENSG00000124216
Ensembl Transcript ID: ENST00000244050
Gene coordinates (GRCh38): 20:49982999-49988886
HGNC Alias: SLUGH2, SNA, SNAH, SNAIL, SNAIL1
HGNC ID: HGNC:11128
HGNC Symbol: SNAI1
NCBI gene: 6615
RefSeq mRNA: NM_005985
Sequence:TTTACCTTCCAGCAGCCCTACGACCAGGCCCACCTGCTGGCAGCCATCCCACCTC
CGGAGATCCTCAACCCCACCGCCTCGCTGCCAATGCTCATCTGGGACTCTGTCCT
GGCGCCCCAAGCCCAGCCAATTGCCTGGGCCTCCCTTCGGCTCCAGGAGAGTCCC
AGGGTGGCAGAGCTGACCTCCCTGTCAGATGAGGACAGTGGGAAAGGCTCCCAGC
CCCCCAGCCCACCCTCACCGGCTCCTTCGTCCTTCTCCTCTACTTCAGTCTCTTC
CTTGGAGGCCGAGGCCTATGCTGCCTTCCCAGGCTTGGGCCAAGTGCCCAAGCAG
CTGGCCCAGCTCTCTGAGGCCAAGGATCTCCAGGCTCGAAAGGCCTTCAACTGCA
AATACTGCAACAAGGAATACCTCAGCCTGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.