Search our product database

Search options:
Product name: hDKC1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03129-1
Sigma Product ID: EHU031291
Species: Homo sapiens
Ensembl Gene ID: ENSG00000130826
Ensembl Transcript ID: ENST00000369550, ENST00000426673, ENST00000620277
Gene coordinates (GRCh38): X:154762742-154777689
HGNC Alias: Cbf5, DKC, dyskerin, NAP57, NOLA4, XAP101
HGNC ID: HGNC:2890
HGNC Symbol: DKC1
NCBI gene: 1736
RefSeq mRNA: NM_001142463, NM_001288747, NM_001363
RefSeq ncRNA: NR_110021, NR_110022, NR_110023
Sequence:TGTGTGCACCTTGGTTTGTTATTGGGAGTTGGTGGTCAGATGCAGGAGCTTCGGA
GGGTTCGTTCTGGAGTCATGAGTGAAAAGGACCACATGGTGACAATGCATGATGT
GCTTGATGCTCAGTGGCTGTATGATAACCACAAGGATGAGAGTTACCTGCGGCGA
GTTGTTTACCCTTTGGAAAAGCTGTTGACATCTCATAAACGGCTGGTTATGAAAG
ACAGTGCAGTAAATGCCATCTGCTATGGGGCCAAGATTATGCTTCCAGGTGTTCT
TCGATATGAGGACGGCATTGAGGTCAATCAGGAGATTGTGGTTATCACCACCAAA
GGAGAAGCAATCTGCATGGCTATTGCATTAATGACCACAGCGGTCATCTCTACCT
GCGACCATGGTATAGTAGCCAAGATCAAGAGAGTGATCATGGAGAGAGACACTTA
CCCTCGGAAGTGGGGTTTAGGTCCAAAGGCAAGTCAGA
Product name: hDKC1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03129-1
Sigma Product ID: EHU031291
Species: Homo sapiens
Ensembl Gene ID: ENSG00000130826
Ensembl Transcript ID: ENST00000369550, ENST00000426673, ENST00000620277
Gene coordinates (GRCh38): X:154762742-154777689
HGNC Alias: Cbf5, DKC, dyskerin, NAP57, NOLA4, XAP101
HGNC ID: HGNC:2890
HGNC Symbol: DKC1
NCBI gene: 1736
RefSeq mRNA: NM_001142463, NM_001288747, NM_001363
RefSeq ncRNA: NR_110021, NR_110022, NR_110023
Sequence:TGTGTGCACCTTGGTTTGTTATTGGGAGTTGGTGGTCAGATGCAGGAGCTTCGGA
GGGTTCGTTCTGGAGTCATGAGTGAAAAGGACCACATGGTGACAATGCATGATGT
GCTTGATGCTCAGTGGCTGTATGATAACCACAAGGATGAGAGTTACCTGCGGCGA
GTTGTTTACCCTTTGGAAAAGCTGTTGACATCTCATAAACGGCTGGTTATGAAAG
ACAGTGCAGTAAATGCCATCTGCTATGGGGCCAAGATTATGCTTCCAGGTGTTCT
TCGATATGAGGACGGCATTGAGGTCAATCAGGAGATTGTGGTTATCACCACCAAA
GGAGAAGCAATCTGCATGGCTATTGCATTAATGACCACAGCGGTCATCTCTACCT
GCGACCATGGTATAGTAGCCAAGATCAAGAGAGTGATCATGGAGAGAGACACTTA
CCCTCGGAAGTGGGGTTTAGGTCCAAAGGCAAGTCAGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.