Search our product database

Search options:
Product name: hGTF2H3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03555-1
Sigma Product ID: EHU035551
Species: Homo sapiens
Ensembl Gene ID: ENSG00000111358
Ensembl Transcript ID: ENST00000536375, ENST00000537368, ENST00000537695, ENST00000538533, ENST00000538845, ENST00000543341, ENST00000543415
Gene coordinates (GRCh38): 12:123633739-123662606
HGNC Alias: BTF2, P34, TFIIH
HGNC ID: HGNC:4657
HGNC Symbol: GTF2H3
NCBI gene: 2967
RefSeq mRNA: NM_001271866, NM_001516
Sequence:AGCCATGGTTTCAGACGAAGATGAATTGAATCTTCTGGTTATTGTAGTTGATGCC
AACCCAATTTGGTGGGGAAAGCAAGCATTAAAGGAATCTCAGTTCACTTTATCCA
AATGCATAGATGCCGTGATGGTGCTGGGAAATTCGCATTTATTCATGAATCGTTC
CAACAAACTTGCTGTGATAGCAAGTCACATTCAAGAAAGCCGATTCTTATATCCT
GGAAAGAATGGCAGACTTGGAGACTTCTTCGGAGACCCTGGCAACCCTCCTGAAT
TTAATCCCTCTGGGAGTAAAGATGGAAAATACGAACTTTTAACCTCAGCAAATGA
AGTTATTGTTGAAGAGATTAAAGATCTAATGACCAAAAGTGACATAAAGGGTCAA
CATACAGAAACTTTGCTGGCAGGATC
Product name: hGTF2H3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03555-1
Sigma Product ID: EHU035551
Species: Homo sapiens
Ensembl Gene ID: ENSG00000111358
Ensembl Transcript ID: ENST00000536375, ENST00000537368, ENST00000537695, ENST00000538533, ENST00000538845, ENST00000543341, ENST00000543415
Gene coordinates (GRCh38): 12:123633739-123662606
HGNC Alias: BTF2, P34, TFIIH
HGNC ID: HGNC:4657
HGNC Symbol: GTF2H3
NCBI gene: 2967
RefSeq mRNA: NM_001271866, NM_001516
Sequence:AGCCATGGTTTCAGACGAAGATGAATTGAATCTTCTGGTTATTGTAGTTGATGCC
AACCCAATTTGGTGGGGAAAGCAAGCATTAAAGGAATCTCAGTTCACTTTATCCA
AATGCATAGATGCCGTGATGGTGCTGGGAAATTCGCATTTATTCATGAATCGTTC
CAACAAACTTGCTGTGATAGCAAGTCACATTCAAGAAAGCCGATTCTTATATCCT
GGAAAGAATGGCAGACTTGGAGACTTCTTCGGAGACCCTGGCAACCCTCCTGAAT
TTAATCCCTCTGGGAGTAAAGATGGAAAATACGAACTTTTAACCTCAGCAAATGA
AGTTATTGTTGAAGAGATTAAAGATCTAATGACCAAAAGTGACATAAAGGGTCAA
CATACAGAAACTTTGCTGGCAGGATC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.