Search our product database

Search options:
Product name: hDBT €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03585-1
Sigma Product ID: EHU035851
Species: Homo sapiens
Ensembl Gene ID: ENSG00000137992
Ensembl Transcript ID: ENST00000370132
Gene coordinates (GRCh38): 1:100186919-100249834
HGNC ID: HGNC:2698
HGNC Symbol: DBT
NCBI gene: 1629
RefSeq mRNA: NM_001918
Sequence:AAAACCCATTGCATTTGCTCGTGGAATTAAACTCTCCTTTATGCCTTTCTTCTTA
AAGGCTGCTTCCTTGGGATTACTACAGTTTCCTATCCTTAACGCTTCTGTGGATG
AAAACTGCCAGAATATAACATATAAGGCTTCTCATAACATTGGGATAGCAATGGA
TACTGAGCAGGGTTTGATTGTCCCTAATGTGAAAAATGTTCAGATCTGCTCTATA
TTTGACATCGCCACTGAACTGAACCGCCTCCAGAAATTGGGCTCTGTGAGTCAGC
TCAGCACCACTGATCTTACAGGAGGAACATTTACTCTTTCCAACATTGGATCAAT
TGGTGGTACCTTTGCCAAACCAGTGATAATGCCACCTGAAGTAGCCATTGGGGCC
CTTGGATCAATTAAGGCCATTCCCC
Product name: hDBT €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03585-1
Sigma Product ID: EHU035851
Species: Homo sapiens
Ensembl Gene ID: ENSG00000137992
Ensembl Transcript ID: ENST00000370132
Gene coordinates (GRCh38): 1:100186919-100249834
HGNC ID: HGNC:2698
HGNC Symbol: DBT
NCBI gene: 1629
RefSeq mRNA: NM_001918
Sequence:AAAACCCATTGCATTTGCTCGTGGAATTAAACTCTCCTTTATGCCTTTCTTCTTA
AAGGCTGCTTCCTTGGGATTACTACAGTTTCCTATCCTTAACGCTTCTGTGGATG
AAAACTGCCAGAATATAACATATAAGGCTTCTCATAACATTGGGATAGCAATGGA
TACTGAGCAGGGTTTGATTGTCCCTAATGTGAAAAATGTTCAGATCTGCTCTATA
TTTGACATCGCCACTGAACTGAACCGCCTCCAGAAATTGGGCTCTGTGAGTCAGC
TCAGCACCACTGATCTTACAGGAGGAACATTTACTCTTTCCAACATTGGATCAAT
TGGTGGTACCTTTGCCAAACCAGTGATAATGCCACCTGAAGTAGCCATTGGGGCC
CTTGGATCAATTAAGGCCATTCCCC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.