Search our product database

Search options:
Product name: hNDFIP2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03654-1
Sigma Product ID: EHU036541
Species: Homo sapiens
Ensembl Gene ID: ENSG00000102471
Ensembl Transcript ID: ENST00000218652, ENST00000487865, ENST00000612570, ENST00000620924, ENST00000650134
Gene coordinates (GRCh38): 13:79481124-79556075
HGNC Alias: KIAA1165, N4wbp5a
HGNC ID: HGNC:18537
HGNC Symbol: NDFIP2
NCBI gene: 54602
RefSeq mRNA: NM_001161407, NM_019080
Sequence:TGTACTTGGCCTGCTCCTTTTCTTCAGAGGATTTGTTAATTATCTAAAAGTCAGA
AACATGTCTGAAAGTATGGCAGCTGCTCATAGAACAAGGTATTTCTTCTTATTGT
AGAGACTGCATCAACCCGACATTCCTTTCTTATACCAATGTGAAATTTCCAGATC
ATCTGTAAACCTACAACTTTAATAGAAGACTACTAATAACAGAAGACAAATTAGT
GAAGAAAAGACGGAGTTTCGAAATTGAATGGCAGGGTGGTTTTTGCTTACAAGCC
ATTTCTGTTCATTCTTTAAGTATCTATATTTCATTTGTTTTGCACATATGCATAT
GTGCCCATTTAAGATATTTGCATATACTTGATAGAAACCATAAAGTTGTAGCAGT
TAAGTCCAGTCACATTTGGTTAATCAGTGTTTGATATAATTGAAAGAGTTGAGTG
GATAAACAGTCTTCCAGCTTGTAAATGCCA
Product name: hNDFIP2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03654-1
Sigma Product ID: EHU036541
Species: Homo sapiens
Ensembl Gene ID: ENSG00000102471
Ensembl Transcript ID: ENST00000218652, ENST00000487865, ENST00000612570, ENST00000620924, ENST00000650134
Gene coordinates (GRCh38): 13:79481124-79556075
HGNC Alias: KIAA1165, N4wbp5a
HGNC ID: HGNC:18537
HGNC Symbol: NDFIP2
NCBI gene: 54602
RefSeq mRNA: NM_001161407, NM_019080
Sequence:TGTACTTGGCCTGCTCCTTTTCTTCAGAGGATTTGTTAATTATCTAAAAGTCAGA
AACATGTCTGAAAGTATGGCAGCTGCTCATAGAACAAGGTATTTCTTCTTATTGT
AGAGACTGCATCAACCCGACATTCCTTTCTTATACCAATGTGAAATTTCCAGATC
ATCTGTAAACCTACAACTTTAATAGAAGACTACTAATAACAGAAGACAAATTAGT
GAAGAAAAGACGGAGTTTCGAAATTGAATGGCAGGGTGGTTTTTGCTTACAAGCC
ATTTCTGTTCATTCTTTAAGTATCTATATTTCATTTGTTTTGCACATATGCATAT
GTGCCCATTTAAGATATTTGCATATACTTGATAGAAACCATAAAGTTGTAGCAGT
TAAGTCCAGTCACATTTGGTTAATCAGTGTTTGATATAATTGAAAGAGTTGAGTG
GATAAACAGTCTTCCAGCTTGTAAATGCCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.