Search our product database

Search options:
Product name: hSTAT5B €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03665-1
Sigma Product ID: EHU036651
Species: Homo sapiens
Ensembl Gene ID: ENSG00000173757
Ensembl Transcript ID: ENST00000293328
Gene coordinates (GRCh38): 17:42199168-42276707
HGNC ID: HGNC:11367
HGNC Symbol: STAT5B
NCBI gene: 6777
RefSeq mRNA: NM_012448
Sequence:TGACGGTGTGATGGAAGTGTTAAAAAAACATCTCAAGCCTCATTGGAATGATGGG
GCCATTTTGGGGTTTGTAAACAAGCAACAGGCCCATGACCTACTCATTAACAAGC
CAGATGGGACCTTCCTCCTGAGATTCAGTGACTCAGAAATTGGCGGCATCACCAT
TGCTTGGAAGTTTGATTCTCAGGAAAGAATGTTTTGGAATCTGATGCCTTTTACC
ACCAGAGACTTCTCCATTCGGTCCCTAGCCGACCGCTTGGGAGACTTGAATTACC
TTATCTACGTGTTTCCTGATCGGCCAAAAGATGAAGTATACTCCAAATACTACAC
ACCAGTTCCCTGCGAGTCTGCTACTGCTAAAGCTGTTGATGGATACGTGAAGCCA
CAGATCAAGCAAGTGGTCCCTGAGT
Product name: hSTAT5B €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03665-1
Sigma Product ID: EHU036651
Species: Homo sapiens
Ensembl Gene ID: ENSG00000173757
Ensembl Transcript ID: ENST00000293328
Gene coordinates (GRCh38): 17:42199168-42276707
HGNC ID: HGNC:11367
HGNC Symbol: STAT5B
NCBI gene: 6777
RefSeq mRNA: NM_012448
Sequence:TGACGGTGTGATGGAAGTGTTAAAAAAACATCTCAAGCCTCATTGGAATGATGGG
GCCATTTTGGGGTTTGTAAACAAGCAACAGGCCCATGACCTACTCATTAACAAGC
CAGATGGGACCTTCCTCCTGAGATTCAGTGACTCAGAAATTGGCGGCATCACCAT
TGCTTGGAAGTTTGATTCTCAGGAAAGAATGTTTTGGAATCTGATGCCTTTTACC
ACCAGAGACTTCTCCATTCGGTCCCTAGCCGACCGCTTGGGAGACTTGAATTACC
TTATCTACGTGTTTCCTGATCGGCCAAAAGATGAAGTATACTCCAAATACTACAC
ACCAGTTCCCTGCGAGTCTGCTACTGCTAAAGCTGTTGATGGATACGTGAAGCCA
CAGATCAAGCAAGTGGTCCCTGAGT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.